Morpholino

MO1-tbx6

ID
ZDB-MRPHLNO-081107-1
Name
MO1-tbx6
Previous Names
None
Target
Sequence
5' - CATTTCCACACCCAGCATGTCTCGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tbx6
Expressed Gene Anatomy Figures
foxd5 Fig. 4 with image from Lee et al., 2009
mespaa Fig. 8 with image from Lee et al., 2009
mespba Fig. 8 with image from Lee et al., 2009
Fig. 1 from Kawamura et al., 2008
myod1 Fig. 8 with image from Lee et al., 2009
tbxta Fig. 1 from Kawamura et al., 2008
xirp2a Fig. S4 with image from Kinoshita et al., 2018
Phenotype
Phenotype resulting from MO1-tbx6
Phenotype Fish Figures
post-vent region decreased length, abnormal WT + MO1-tbx6 Fig. 3 with image,  Fig. S2 with image from Blaker-Lee et al., 2012
post-vent region shape, abnormal WT + MO1-tbx6 Fig. 3 with image from Blaker-Lee et al., 2012
somite deformed, abnormal WT + MO1-tbx6 Fig. 8 with image from Lee et al., 2009
somite disorganized, abnormal WT + MO1-tbx6 Fig. 8 with image from Lee et al., 2009
somite fused with somite, abnormal WT + MO1-tbx6 Fig. S2 with image from Blaker-Lee et al., 2012
somite U-shaped, abnormal WT + MO1-tbx6 Fig. 3 with image from Blaker-Lee et al., 2012
somite border aplastic, abnormal WT + MO1-tbx6 Fig. 8 with image from Lee et al., 2009
somite border inconspicuous, abnormal WT + MO1-tbx6 Fig. S2 with image from Blaker-Lee et al., 2012
somitogenesis disrupted, abnormal WT + MO1-tbx6 Fig. 8 with image from Lee et al., 2009
thigmotaxis decreased process quality, abnormal WT + MO1-tbx6 Fig. 3 with image from Blaker-Lee et al., 2012
Phenotype of all Fish created by or utilizing MO1-tbx6
Phenotype Fish Conditions Figures
post-vent region shape, abnormal WT + MO1-tbx6 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
somite fused with somite, abnormal WT + MO1-tbx6 standard conditions Fig. S2 with image from Blaker-Lee et al., 2012
somite U-shaped, abnormal WT + MO1-tbx6 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
somite border inconspicuous, abnormal WT + MO1-tbx6 standard conditions Fig. S2 with image from Blaker-Lee et al., 2012
somite deformed, abnormal WT + MO1-tbx6 standard conditions Fig. 8 with image from Lee et al., 2009
post-vent region decreased length, abnormal WT + MO1-tbx6 standard conditions Fig. 3 with image,  Fig. S2 with image from Blaker-Lee et al., 2012
somitogenesis disrupted, abnormal WT + MO1-tbx6 standard conditions Fig. 8 with image from Lee et al., 2009
thigmotaxis decreased process quality, abnormal WT + MO1-tbx6 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
somite border aplastic, abnormal WT + MO1-tbx6 standard conditions Fig. 8 with image from Lee et al., 2009
somite disorganized, abnormal WT + MO1-tbx6 standard conditions Fig. 8 with image from Lee et al., 2009
somite border morphology, ameliorated ripply1sud101/sud101 + MO1-tbx6 standard conditions Fig. S4 with image from Kinoshita et al., 2018
myotome morphology, ameliorated ripply1sud101/sud101 + MO1-tbx6 standard conditions Fig. S4 with image from Kinoshita et al., 2018
somite border morphology, abnormal ripply1sud101/sud101 + MO1-tbx6 standard conditions Fig. S4 with image from Kinoshita et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.