Morpholino

MO4-bmp4

ID

ZDB-MRPHLNO-080919-1

Name

MO4-bmp4

Previous Names

Target

Sequence

5' - AACAGTCCATGTTTGTCGAGAGGTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-bmp4

Expressed Gene	Anatomy	Figures
pax2a	pronephric mesoderm	Fig. 6 from Weber et al., 2008
wt1a	pronephric glomerulus pronephric mesoderm pronephric tubule	Fig. 6, Fig. 7 from Weber et al., 2008

Phenotype

Phenotype resulting from MO4-bmp4

Phenotype	Fish	Figures
notochord increased width, abnormal	WT + MO4-bmp4	text only from Weber et al., 2008
polarity specification of dorsal/ventral axis disrupted, abnormal	WT + MO4-bmp4	text only from Weber et al., 2008
post-vent region decreased length, abnormal	WT + MO4-bmp4	text only from Weber et al., 2008
post-vent region morphology, abnormal	WT + MO4-bmp4	text only from Weber et al., 2008
pronephric glomerulus morphology, abnormal	WT + MO4-bmp4	Fig. 6, Fig. 7 from Weber et al., 2008
pronephros development disrupted, abnormal	WT + MO4-bmp4	Fig. 6, Fig. 7 from Weber et al., 2008
somite increased width, abnormal	WT + MO4-bmp4	text only from Weber et al., 2008
tail bud aplastic, abnormal	WT + MO4-bmp4	text only from Weber et al., 2008
whole organism wholly dorsalized, abnormal	WT + MO4-bmp4	text only from Weber et al., 2008

Phenotype of all Fish created by or utilizing MO4-bmp4

Phenotype	Fish	Conditions	Figures
notochord increased width, abnormal	WT + MO4-bmp4	standard conditions	text only from Weber et al., 2008
somite increased width, abnormal	WT + MO4-bmp4	standard conditions	text only from Weber et al., 2008
post-vent region morphology, abnormal	WT + MO4-bmp4	standard conditions	text only from Weber et al., 2008
pronephric glomerulus morphology, abnormal	WT + MO4-bmp4	standard conditions	Fig. 6, Fig. 7 from Weber et al., 2008
polarity specification of dorsal/ventral axis disrupted, abnormal	WT + MO4-bmp4	standard conditions	text only from Weber et al., 2008
tail bud aplastic, abnormal	WT + MO4-bmp4	standard conditions	text only from Weber et al., 2008
pronephros development disrupted, abnormal	WT + MO4-bmp4	standard conditions	Fig. 6, Fig. 7 from Weber et al., 2008
post-vent region decreased length, abnormal	WT + MO4-bmp4	standard conditions	text only from Weber et al., 2008
whole organism wholly dorsalized, abnormal	WT + MO4-bmp4	standard conditions	text only from Weber et al., 2008

Citations