Morpholino
MO2-mif
- ID
- ZDB-MRPHLNO-080708-5
- Name
- MO2-mif
- Previous Names
- None
- Target
- Sequence
-
5' - CCATCAGTGTGAATGTACCTGTCAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a splice blocking morpholino that targets mif.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-mif
No data available
Phenotype
Phenotype resulting from MO2-mif
| Phenotype | Fish | Figures |
|---|---|---|
| eye decreased size, abnormal | WT + MO2-mif |
text only
from Ito et al., 2008 |
| eye malformed, abnormal | WT + MO2-mif |
text only
from Ito et al., 2008 |
| optic tectum swollen, abnormal | WT + MO2-mif |
text only
from Ito et al., 2008 |
Phenotype of all Fish created by or utilizing MO2-mif
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| optic tectum swollen, abnormal | WT + MO2-mif | standard conditions |
text only
from Ito et al., 2008 |
| eye decreased size, abnormal | WT + MO2-mif | standard conditions |
text only
from Ito et al., 2008 |
| eye malformed, abnormal | WT + MO2-mif | standard conditions |
text only
from Ito et al., 2008 |
Citations