Morpholino
MO1-fgfr4
- ID
- ZDB-MRPHLNO-080626-4
- Name
- MO1-fgfr4
- Previous Names
- None
- Target
- Sequence
-
5' - ATATCTGCTGGAGTAAAAAATGAGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice blocking morpholino.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fgfr4
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| efna3b |
Fig. 10 
from Nakayama et al., 2008 |
|
| mafa |
|
Fig. 10
from Nakayama et al., 2008 |
1 - 2 of 2
Phenotype
Phenotype resulting from MO1-fgfr4
| Phenotype | Fish | Figures |
|---|---|---|
| optic cup morphology, abnormal | WT + MO1-fgfr4 |
Fig. 10
from Nakayama et al., 2008 |
| solid lens vesicle morphology, abnormal | WT + MO1-fgfr4 |
Fig. 10
from Nakayama et al., 2008 |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-fgfr4
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| optic cup morphology, abnormal | WT + MO1-fgfr4 | standard conditions |
Fig. 10
from Nakayama et al., 2008 |
| solid lens vesicle morphology, abnormal | WT + MO1-fgfr4 | standard conditions |
Fig. 10
from Nakayama et al., 2008 |
1 - 2 of 2
Citations
- Liu, D.W., Tsai, S.M., Lin, B.F., Jiang, Y.J., and Wang, W.P. (2013) Fibroblast growth factor receptor 2c signaling is required for intestinal cell differentiation in zebrafish. PLoS One. 8(3):e58310
- Nakayama, Y., Miyake, A., Nakagawa, Y., Mido, T., Yoshikawa, M., Konishi, M., and Itoh, N. (2008) Fgf19 is required for zebrafish lens and retina development. Developmental Biology. 313(2):752-766
1 - 2 of 2
Show