Morpholino

MO1-tjp3

ID

ZDB-MRPHLNO-080623-1

Name

MO1-tjp3

Previous Names

None

Target

tjp3 (1)

Sequence

5' - GCTCCCATATCGTCATCTCCTCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tjp3

No data available

Phenotype

Phenotype resulting from MO1-tjp3

Phenotype	Fish	Figures
blood circulation arrested, abnormal	AB + MO1-tjp3	Fig. 2 , Fig. 4 from Kiener et al., 2008
blood island increased size, abnormal	AB + MO1-tjp3	Fig. 2 from Kiener et al., 2008
caudal fin decreased size, abnormal	AB + MO1-tjp3	Fig. 2 , Fig. 4 from Kiener et al., 2008
EVL lacks parts or has fewer parts of type EVL bicellular tight junction, abnormal	AB + MO1-tjp3	Fig. 6 from Kiener et al., 2008
EVL bicellular tight junction decreased amount, abnormal	AB + MO1-tjp3	Fig. 6 from Kiener et al., 2008
pericardium edematous, abnormal	AB + MO1-tjp3	Fig. 2 , Fig. 4 from Kiener et al., 2008
post-vent region decreased length, abnormal	AB + MO1-tjp3	Fig. 2 from Kiener et al., 2008
post-vent region increased curvature, abnormal	AB + MO1-tjp3	Fig. 2 from Kiener et al., 2008
post-vent region structure, abnormal	AB + MO1-tjp3	Fig. 4 from Kiener et al., 2008
whole organism decreased length, abnormal	AB + MO1-tjp3	Fig. 2 from Kiener et al., 2008

Phenotype of all Fish created by or utilizing MO1-tjp3

Phenotype	Fish	Conditions	Figures
post-vent region increased curvature, abnormal	AB + MO1-tjp3	standard conditions	Fig. 2 from Kiener et al., 2008
post-vent region structure, abnormal	AB + MO1-tjp3	standard conditions	Fig. 4 from Kiener et al., 2008
whole organism decreased length, abnormal	AB + MO1-tjp3	standard conditions	Fig. 2 from Kiener et al., 2008
post-vent region decreased length, abnormal	AB + MO1-tjp3	standard conditions	Fig. 2 from Kiener et al., 2008
EVL lacks parts or has fewer parts of type EVL bicellular tight junction, abnormal	AB + MO1-tjp3	standard conditions	Fig. 6 from Kiener et al., 2008
pericardium edematous, abnormal	AB + MO1-tjp3	standard conditions	Fig. 2 , Fig. 4 from Kiener et al., 2008
caudal fin decreased size, abnormal	AB + MO1-tjp3	standard conditions	Fig. 2 , Fig. 4 from Kiener et al., 2008
EVL bicellular tight junction decreased amount, abnormal	AB + MO1-tjp3	standard conditions	Fig. 6 from Kiener et al., 2008
blood circulation arrested, abnormal	AB + MO1-tjp3	standard conditions	Fig. 2 , Fig. 4 from Kiener et al., 2008
blood island increased size, abnormal	AB + MO1-tjp3	standard conditions	Fig. 2 from Kiener et al., 2008
epiboly increased duration, abnormal	WT + MO1-tjp3 + MO2-tjp1b	standard conditions	Fig. 2 from Schwayer et al., 2019
actomyosin contractile ring assembly decreased occurrence, abnormal	WT + MO1-tjp3 + MO2-tjp1b	standard conditions	Fig. 2 from Schwayer et al., 2019
EVL tight junction tension, abnormal	WT + MO1-tjp3 + MO2-tjp1b	standard conditions	Fig. 2 from Schwayer et al., 2019

Citations