Morpholino
MO2-cep290
- ID
- ZDB-MRPHLNO-080428-3
- Name
- MO2-cep290
- Previous Names
-
- spMO (1)
- Target
- Sequence
-
5' - AAAGTTGCACCTACAGAGGGTCTGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cep290
No data available
Phenotype
Phenotype resulting from MO2-cep290
1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO2-cep290
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| otolith amount, abnormal | AB/TU + MO2-cep290 | control |
Fig. S1
from Cardenas-Rodriguez et al., 2021 |
| post-vent region curved ventral, abnormal | AB/TU + MO2-cep290 | control |
Fig. S1
from Cardenas-Rodriguez et al., 2021 |
| heart determination of heart left/right asymmetry process quality, abnormal | AB/TU + MO2-cep290 | control |
Fig. S1
from Cardenas-Rodriguez et al., 2021 |
| axis curved ventral, abnormal | AB/TU + MO2-cep290 | control |
Fig. S1
from Cardenas-Rodriguez et al., 2021 |
| kidney cystic, abnormal | AB/TU + MO2-cep290 | control |
Fig. S1
from Cardenas-Rodriguez et al., 2021 |
1 - 5 of 14 Show all
Citations
- Cardenas-Rodriguez, M., Austin-Tse, C., Bergboer, J.G.M., Molinari, E., Sugano, Y., Bachmann-Gagescu, R., Sayer, J.A., Drummond, I.A. (2021) Genetic compensation for cilia defects in cep290/NPHP6 mutants by upregulation of cilia-associated small GTPases. Journal of Cell Science. 134(14):
- Gorden, N.T., Arts, H.H., Parisi, M.A., Coene, K.L., Letteboer, S.J., van Beersum, S.E., Mans, D.A., Hikida, A., Eckert, M., Knutzen, D., Alswaid, A.F., Ozyurek, H., Dibooglu, S., Otto, E.A., Liu, Y., Davis, E.E., Hutter, C.M., Bammler, T.K., Farin, F.M., Dorschner, M., Topçu, M., Zackai, E.H., Rosenthal, P., Owens, K.N., Katsanis, N., Vincent, J.B., Hildebrandt, F., Rubel, E.W., Raible, D.W., Knoers, N.V., Chance, P.F., Roepman, R., Moens, C.B., Glass, I.A., and Doherty, D. (2008) CC2D2A Is Mutated in Joubert Syndrome and Interacts with the Ciliopathy-Associated Basal Body Protein CEP290. American journal of human genetics. 83(5):559-571
- Sayer, J.A., Otto, E.A., O'toole, J.F., Nurnberg, G., Kennedy, M.A., Becker, C., Hennies, H.C., Helou, J., Attanasio, M., Fausett, B.V., Utsch, B., Khanna, H., Liu, Y., Drummond, I., Kawakami, I., Kusakabe, T., Tsuda, M., Ma, L., Lee, H., Larson, R.G., Allen, S.J., Wilkinson, C.J., Nigg, E.A., Shou, C., Lillo, C., Williams, D.S., Hoppe, B., Kemper, M.J., Neuhaus, T., Parisi, M.A., Glass, I.A., Petry, M., Kispert, A., Gloy, J., Ganner, A., Walz, G., Zhu, X., Goldman, D., Nurnberg, P., Swaroop, A., Leroux, M.R., and Hildebrandt, F. (2006) The centrosomal protein nephrocystin-6 is mutated in Joubert syndrome and activates transcription factor ATF4. Nature Genetics. 38(6):674-681
1 - 3 of 3
Show