Morpholino
MO1-itgb1b
- ID
- ZDB-MRPHLNO-080319-2
- Name
- MO1-itgb1b
- Previous Names
- None
- Target
- Sequence
-
5' - AATCAGGAGCAGCCTTACGTCCATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-itgb1b
Expressed Gene | Anatomy | Figures |
---|---|---|
runx1 |
Fig. 6 ![]() |
1 - 1 of 1
Phenotype
Phenotype resulting from MO1-itgb1b
1 - 5 of 16 Show all
Phenotype of all Fish created by or utilizing MO1-itgb1b
1 - 5 of 18 Show all
Citations
- Rho, S.S., Kobayashi, I., Oguri-Nakamura, E., Ando, K., Fujiwara, M., Kamimura, N., Hirata, H., Iida, A., Iwai, Y., Mochizuki, N., Fukuhara, S. (2019) Rap1b Promotes Notch-Signal-Mediated Hematopoietic Stem Cell Development by Enhancing Integrin-Mediated Cell Adhesion. Developmental Cell. 49(5):681-696.e6
- Wu, Q., Zhang, J., Koh, W., Yu, Q., Zhu, X., Amsterdam, A., Davis, G.E., Arnaout, M.A., Xiong, J.W. (2015) Talin1 is required for cardiac Z-disk stabilization and endothelial integrity in zebrafish. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 29(12):4989-5005
- Compagnon, J., Barone, V., Rajshekar, S., Kottmeier, R., Pranjic-Ferscha, K., Behrndt, M., Heisenberg, C. (2014) The Notochord Breaks Bilateral Symmetry by Controlling Cell Shapes in the Zebrafish Laterality Organ. Developmental Cell. 31:774-783
- Xiao, T., and Baier, H. (2007) Lamina-specific axonal projections in the zebrafish tectum require the type IV collagen Dragnet. Nature Neuroscience. 10(12):1529-1537
1 - 4 of 4
Show