Morpholino
MO2-ponzr1
- ID
- ZDB-MRPHLNO-070727-4
- Name
- MO2-ponzr1
- Previous Names
-
- SP2054 MO2 (1)
- Target
- Sequence
-
5' - CCGTAGTAGAAATTGCTGCCATGAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ponzr1
No data available
Phenotype
Phenotype resulting from MO2-ponzr1
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO2-ponzr1
1 - 5 of 11 Show all
Citations
- Bedell, V.M., Person, A.D., Larson, J.D., McLoon, A., Balciunas, D., Clark, K.J., Neff, K.I., Nelson, K.E., Bill, B.R., Schimmenti, L.A., Beiraghi, S., and Ekker, S.C. (2012) The lineage-specific gene ponzr1 is essential for zebrafish pronephric and pharyngeal arch development. Development (Cambridge, England). 139(4):793-804
- Robu, M.E., Larson, J.D., Nasevicius, A., Beiraghi, S., Brenner, C., Farber, S.A., and Ekker, S.C. (2007) p53 activation by knockdown technologies. PLoS Genetics. 3(5):e78
- Pickart, M.A., Klee, E.W., Nielsen, A.L., Sivasubbu, S., Mendenhall, E.M., Bill B.R., Chen, E., Eckfeldt, C.E., Knowlton, M., Robu, M.E., Larson, J.D., Deng, Y., Schimmenti, L.A., Ellis, L.B., Verfaillie, C.M., Hammerschmidt, M., Farber, S.A., and Ekker, S.C. (2006) Genome-wide reverse genetics framework to identify novel functions of the vertebrate secretome. PLoS One. 1(1):e104
1 - 3 of 3
Show