Morpholino

MO1-ponzr1

ID
ZDB-MRPHLNO-070727-3
Name
MO1-ponzr1
Previous Names
  • SP2054 MO1 (1)
Target
Sequence
5' - GAAGTCCTTGTCTTGTGTGGAGCAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ponzr1
Phenotype
Phenotype resulting from MO1-ponzr1
Phenotype Fish Figures
ceratohyal cartilage deformed, abnormal WT + MO1-ponzr1 Fig. 6 with image from Robu et al., 2007
head decreased size, abnormal WT + MO1-ponzr1 Fig. 6 with image from Robu et al., 2007
Meckel's cartilage deformed, abnormal WT + MO1-ponzr1 Fig. 6 with image from Robu et al., 2007
nervous system apoptotic, abnormal WT + MO1-ponzr1 Fig. 6 with image from Robu et al., 2007
pharyngeal arch aplastic, abnormal WT + MO1-ponzr1 Fig. 7 with image from Bedell et al., 2012
pharyngeal arch 3-7 skeleton aplastic, abnormal WT + MO1-ponzr1 Fig. S6 with image from Bedell et al., 2012
Fig. 6 with image from Robu et al., 2007
pronephric glomerular capillary hypoplastic, abnormal WT + MO1-ponzr1 Fig. 6 with image from Bedell et al., 2012
pronephric glomerular capillary non-functional, abnormal WT + MO1-ponzr1 Fig. 6 with image from Bedell et al., 2012
pronephric glomerulus aplastic, abnormal WT + MO1-ponzr1 Fig. 5 with image from Bedell et al., 2012
pronephric podocyte fused with pronephric podocyte, abnormal WT + MO1-ponzr1 Fig. 4 with image from Bedell et al., 2012
pronephric tubule dilated, abnormal WT + MO1-ponzr1 Fig. 5 with image from Bedell et al., 2012
pronephric tubule anterior region fused with pronephric tubule anterior region, abnormal WT + MO1-ponzr1 Fig. 4 with image from Bedell et al., 2012
pronephric tubule anterior region malformed, abnormal li1Tg + MO1-ponzr1 Fig. 5 with image from Bedell et al., 2012
pronephros anterior region deformed, abnormal WT + MO1-ponzr1 Fig. 4 with image from Bedell et al., 2012
renal tubule morphology, abnormal WT + MO1-ponzr1 text only from Pickart et al., 2006
Phenotype of all Fish created by or utilizing MO1-ponzr1
Phenotype Fish Conditions Figures
pronephric tubule dilated, abnormal WT + MO1-ponzr1 standard conditions Fig. 5 with image from Bedell et al., 2012
pronephric tubule anterior region fused with pronephric tubule anterior region, abnormal WT + MO1-ponzr1 standard conditions Fig. 4 with image from Bedell et al., 2012
pronephric glomerulus aplastic, abnormal WT + MO1-ponzr1 standard conditions Fig. 5 with image from Bedell et al., 2012
pronephric glomerular capillary hypoplastic, abnormal WT + MO1-ponzr1 standard conditions Fig. 6 with image from Bedell et al., 2012
nervous system apoptotic, abnormal WT + MO1-ponzr1 standard conditions Fig. 6 with image from Robu et al., 2007
pharyngeal arch 3-7 skeleton aplastic, abnormal WT + MO1-ponzr1 standard conditions Fig. S6 with image from Bedell et al., 2012
Fig. 6 with image from Robu et al., 2007
pharyngeal arch aplastic, abnormal WT + MO1-ponzr1 standard conditions Fig. 7 with image from Bedell et al., 2012
ceratohyal cartilage deformed, abnormal WT + MO1-ponzr1 standard conditions Fig. 6 with image from Robu et al., 2007
pronephros anterior region deformed, abnormal WT + MO1-ponzr1 standard conditions Fig. 4 with image from Bedell et al., 2012
head decreased size, abnormal WT + MO1-ponzr1 standard conditions Fig. 6 with image from Robu et al., 2007
Meckel's cartilage deformed, abnormal WT + MO1-ponzr1 standard conditions Fig. 6 with image from Robu et al., 2007
pronephric podocyte fused with pronephric podocyte, abnormal WT + MO1-ponzr1 standard conditions Fig. 4 with image from Bedell et al., 2012
pronephric glomerular capillary non-functional, abnormal WT + MO1-ponzr1 standard conditions Fig. 6 with image from Bedell et al., 2012
renal tubule morphology, abnormal WT + MO1-ponzr1 standard conditions text only from Pickart et al., 2006
pronephric glomerulus aplastic, abnormal li1Tg + MO1-ponzr1 standard conditions Fig. 5 with image from Bedell et al., 2012
pronephric tubule anterior region malformed, abnormal li1Tg + MO1-ponzr1 standard conditions Fig. 5 with image from Bedell et al., 2012
Citations