Morpholino

MO3-dll4

ID
ZDB-MRPHLNO-070626-1
Name
MO3-dll4
Previous Names
  • MO[dll4] (1)
Target
Sequence
5' - TAGGGTTTAGTCTTACCTTGGTCAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-dll4
No data available
Phenotype
Phenotype resulting from MO3-dll4
Phenotype Fish Figures
blood circulation decreased rate, abnormal y1Tg + MO3-dll4 Fig. 2 with image from Leslie et al., 2007
blood vessel endothelial cell increased amount, abnormal WT + MO3-dll4 Fig. 2 with image from Leslie et al., 2007
cranial vasculature branchiness, abnormal y1Tg + MO3-dll4 Fig. S8 from Fukui et al., 2009
dorsal aorta morphology, abnormal y1Tg + MO3-dll4 Fig. 2 with image from Leslie et al., 2007
endothelial cell cytoplasm GCaMP expression spatial pattern, abnormal ncv31Tg; ubs4Tg; zf415Tg + MO3-dll4 Fig. 10 with image from Yokota et al., 2015
endothelial tip cell GCaMP expression spatial pattern, abnormal ncv31Tg; ubs4Tg; zf415Tg + MO3-dll4 Fig. 8 with image from Yokota et al., 2015
intersegmental vessel has extra parts of type endothelial cell, abnormal ncv3Tg; ncv5Tg + MO3-dll4 Fig. 3 with image from Fukuhara et al., 2014
intersegmental vessel morphology, abnormal y1Tg + MO3-dll4 Fig. 2 with imageFig. 3 with image from Leslie et al., 2007
intersegmental vessel cell increased amount, abnormal y1Tg + MO3-dll4 Fig. S8 from Fukui et al., 2009
pericardium edematous, abnormal y1Tg + MO3-dll4 Fig. S8 from Fukui et al., 2009
posterior cardinal vein morphology, abnormal y1Tg + MO3-dll4 Fig. 2 with image from Leslie et al., 2007
regulation of blood vessel endothelial cell migration disrupted, abnormal y1Tg + MO3-dll4 Fig. 3 with image from Leslie et al., 2007
trunk vasculature branchiness, abnormal y1Tg + MO3-dll4 Fig. S8 from Fukui et al., 2009
trunk vasculature blood vessel endothelial cell mCherry expression decreased amount, abnormal ncv69Tg; s939Tg + MO3-dll4 Fig. 4 with image from Ando et al., 2019
Phenotype of all Fish created by or utilizing MO3-dll4
Phenotype Fish Conditions Figures
blood vessel endothelial cell increased amount, abnormal WT + MO3-dll4 standard conditions Fig. 2 with image from Leslie et al., 2007
lymphangioblast cord absent, abnormal WT + MO3-dll4 + MO4-dll4 standard conditions Fig. 2 from Geudens et al., 2010
lymphangioblast cord absent, abnormal hu4453Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 2 from Geudens et al., 2010
regulation of blood vessel endothelial cell migration disrupted, abnormal y1Tg + MO3-dll4 standard conditions Fig. 3 with image from Leslie et al., 2007
trunk vasculature branchiness, abnormal y1Tg + MO3-dll4 standard conditions Fig. S8 from Fukui et al., 2009
posterior cardinal vein morphology, abnormal y1Tg + MO3-dll4 standard conditions Fig. 2 with image from Leslie et al., 2007
intersegmental vessel morphology, abnormal y1Tg + MO3-dll4 standard conditions Fig. 2 with imageFig. 3 with image from Leslie et al., 2007
pericardium edematous, abnormal y1Tg + MO3-dll4 standard conditions Fig. S8 from Fukui et al., 2009
intersegmental vessel cell increased amount, abnormal y1Tg + MO3-dll4 standard conditions Fig. S8 from Fukui et al., 2009
dorsal aorta morphology, abnormal y1Tg + MO3-dll4 standard conditions Fig. 2 with image from Leslie et al., 2007
cranial vasculature branchiness, abnormal y1Tg + MO3-dll4 standard conditions Fig. S8 from Fukui et al., 2009
blood circulation decreased rate, abnormal y1Tg + MO3-dll4 standard conditions Fig. 2 with image from Leslie et al., 2007
thoracic duct wholeness, abnormal y1Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 1Fig. 4 from Geudens et al., 2010
lymphangiogenesis disrupted, abnormal y1Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 1Fig. 4 from Geudens et al., 2010
thoracic duct absent, abnormal y1Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 1 from Geudens et al., 2010
branching involved in lymph vessel morphogenesis disrupted, abnormal y1Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 4 from Geudens et al., 2010
lymphangiogenic sprout decreased amount, abnormal y1Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 4 from Geudens et al., 2010
venous endothelial cell migration involved in lymph vessel development disrupted, abnormal y1Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 4 from Geudens et al., 2010
thoracic duct hypotrophic, abnormal y1Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 4 from Geudens et al., 2010
lymphangioblast cord absent, abnormal y1Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 4 from Geudens et al., 2010
intersegmental vessel has extra parts of type endothelial cell, abnormal ncv3Tg; ncv5Tg + MO3-dll4 standard conditions Fig. 3 with image from Fukuhara et al., 2014
endothelial cell cytoplasm GCaMP expression spatial pattern, abnormal ncv31Tg; ubs4Tg; zf415Tg + MO3-dll4 standard conditions Fig. 10 with image from Yokota et al., 2015
endothelial tip cell GCaMP expression spatial pattern, abnormal ncv31Tg; ubs4Tg; zf415Tg + MO3-dll4 standard conditions Fig. 8 with image from Yokota et al., 2015
trunk vasculature blood vessel endothelial cell mCherry expression decreased amount, abnormal ncv69Tg; s939Tg + MO3-dll4 standard conditions Fig. 4 with image from Ando et al., 2019
intersegmental vessel decreased length, ameliorated s843Tg + MO1-egfl6 + MO3-dll4 standard conditions Fig. 7 with image from Wang et al., 2016
intersegmental vessel endothelial cell amount, ameliorated y7Tg + MO1-egfl6 + MO3-dll4 standard conditions Fig. 7 with image from Wang et al., 2016
intersegmental vein vascular sprouts increased amount, exacerbated flt1ka601/ka601; s843Tg + MO3-dll4 standard conditions Fig. 5 with image from Wild et al., 2017
intersegmental vein increased amount, abnormal flt1ka601/ka601; s843Tg + MO3-dll4 standard conditions Fig. 5 with image from Wild et al., 2017
intersegmental vein dorsal region branchiness, exacerbated flt1ka601/ka601; s843Tg + MO3-dll4 standard conditions Fig. 5 with image from Wild et al., 2017
intersegmental vessel dorsal region branchiness, exacerbated flt1ka601/ka601; s843Tg + MO3-dll4 standard conditions Fig. 5 with image from Wild et al., 2017
intersegmental vessel vascular sprouts increased amount, exacerbated flt1ka601/ka601; s843Tg + MO3-dll4 standard conditions Fig. 5 with image from Wild et al., 2017
intersegmental artery decreased amount, abnormal flt1ka601/ka601; s843Tg + MO3-dll4 standard conditions Fig. 5 with image from Wild et al., 2017
intersegmental artery absent, abnormal hu4624Tg; s916Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 2 from Geudens et al., 2010
intersegmental vessel has extra parts of type intersegmental vein, abnormal hu4624Tg; s916Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 2 from Geudens et al., 2010
intersegmental vessel endothelial cell amount, ameliorated s916Tg; y7Tg + MO1-itgb1a + MO3-dll4 standard conditions Fig. 7 with image from Wang et al., 2016
intersegmental vessel decreased length, ameliorated s916Tg; y7Tg + MO1-itgb1a + MO3-dll4 standard conditions Fig. 7 with image from Wang et al., 2016
Citations