Morpholino
MO2-foxi3a
- ID
- ZDB-MRPHLNO-070321-6
- Name
- MO2-foxi3a
- Previous Names
-
- MO5-foxi3a
- Target
- Sequence
-
5' - GAGAAAATGCCTCCTGCTCTGCTGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-foxi3a
No data available
Phenotype
Phenotype resulting from MO2-foxi3a
Phenotype | Fish | Figures |
---|---|---|
epidermal cell differentiation disrupted, abnormal | WT + MO2-foxi3a |
Fig. 4
from Esaki et al., 2007 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-foxi3a
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
epidermal cell differentiation disrupted, abnormal | WT + MO2-foxi3a | standard conditions |
Fig. 4
from Esaki et al., 2007 |
1 - 1 of 1
Citations
- Esaki, M., Hoshijima, K., Nakamura, N., Munakata, K., Tanaka, M., Ookata, K., Asakawa, K., Kawakami, K., Wang, W., Weinberg, E.S., and Hirose, S. (2009) Mechanism of development of ionocytes rich in vacuolar-type H(+)-ATPase in the skin of zebrafish larvae. Developmental Biology. 329(1):116-129
- Esaki, M., Hoshijima, K., Kobayashi, S., Fukuda, H., Kawakami, K., and Hirose, S. (2007) Visualization in zebrafish larvae of Na+ uptake in mitochondrion-rich cells whose differentiation is dependent on foxi3{alpha}. American journal of physiology. Regulatory, integrative and comparative physiology. 292(1):R470-R480
1 - 2 of 2
Show