Morpholino
MO1-furina
- ID
- ZDB-MRPHLNO-060822-5
- Name
- MO1-furina
- Previous Names
- None
- Target
- Sequence
-
5' - GAGGGACTCACAATCTGTTTCTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a splice blocker for furina exon 9
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-furina
No data available
Phenotype
Phenotype resulting from MO1-furina
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-furina
1 - 5 of 7 Show all
Citations
- Luo, L., Jia, W., Zhang, Y., Guo, Y., Zhu, J., Li, C. (2023) Proprotein Convertase Furin Regulates Melanogenesis via the Notch Signaling Pathway. Discovery medicine. 35:144156144-156
- Klaver, E.J., Dukes-Rimsky, L., Kumar, B., Xia, Z.J., Dang, T., Lehrman, M.A., Angel, P., Drake, R.R., Freeze, H.H., Steet, R., Flanagan-Steet, H. (2021) Protease-dependent defects in N-cadherin processing drive PMM2-CDG pathogenesis. JCI insight. 6(24):
- Gibert, Y., Lattanzi, V.J., Zhen, A.W., Vedder, L., Brunet, F., Faasse, S.A., Babitt, J.L., Lin, H.Y., Hammerschmidt, M., and Fraenkel, P.G. (2011) BMP Signaling Modulates Hepcidin Expression in Zebrafish Embryos Independent of Hemojuvelin. PLoS One. 6(1):e14553
- Walker, M.B., Miller, C.T., Talbot, J.C., Stock, D.W., and Kimmel, C.B. (2006) Zebrafish furin mutants reveal intricacies in regulating Endothelin1 signaling in craniofacial patterning. Developmental Biology. 295(1):194-205
1 - 4 of 4
Show