Morpholino

MO1-krit1

ID

ZDB-MRPHLNO-060821-1

Name

MO1-krit1

Previous Names

None

Target

krit1 (1)

Sequence

5' - GCTTTATTTCACCTCACCTCATAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Targets the exon 1 donor site.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-krit1

Expressed Gene	Anatomy	Figures
rasip1	dorsal longitudinal anastomotic vessel cell-cell junction	Fig. 8. from Lee et al., 2021

Phenotype

Phenotype resulting from MO1-krit1

Phenotype	Fish	Figures
atrium dilated, abnormal	TU + MO1-krit1	Fig. 4 from Rosen et al., 2013
blood circulation disrupted, abnormal	WT + MO1-krit1	Fig. S6 from Gore et al., 2008
blood vessel morphogenesis decreased process quality, abnormal	s843Tg + MO1-krit1	Fig. 6, Fig. 7 from Mleynek et al., 2014
caudal vein plexus angiogenic sprout increased amount, abnormal	s843Tg + MO1-krit1	Fig. 6, Fig. 7 from Mleynek et al., 2014
caudal vein plexus sprouting angiogenesis increased occurrence, abnormal	s843Tg + MO1-krit1	Fig. 6, Fig. 7 from Mleynek et al., 2014
dorsal longitudinal anastomotic vessel cell-cell junction rasip1 expression decreased amount, abnormal	s843Tg + MO1-krit1	Fig. 8. from Lee et al., 2021
dorsal longitudinal anastomotic vessel cell-cell junction rasip1 expression mislocalised, abnormal	s843Tg + MO1-krit1	Fig. 8. from Lee et al., 2021
heart increased size, abnormal	WT + MO1-krit1	Fig. S6 from Gore et al., 2008
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal	s843Tg + MO1-krit1	Fig. 8. from Lee et al., 2021
intersegmental vessel cell-cell junction assembly decreased process quality, abnormal	s843Tg + MO1-krit1	Fig. 8. from Lee et al., 2021
post-vent vasculature morphology, abnormal	s843Tg + MO1-krit1	Fig. 6, Fig. 7 from Mleynek et al., 2014
sinus venosus dilated, abnormal	TU + MO1-krit1	Fig. 4 from Rosen et al., 2013

Phenotype of all Fish created by or utilizing MO1-krit1

Phenotype	Fish	Conditions	Figures
sinus venosus dilated, abnormal	TU + MO1-krit1	standard conditions	Fig. 4 from Rosen et al., 2013
atrium dilated, abnormal	TU + MO1-krit1	standard conditions	Fig. 4 from Rosen et al., 2013
heart increased size, abnormal	WT + MO1-krit1	standard conditions	Fig. S6 from Gore et al., 2008
blood circulation disrupted, abnormal	WT + MO1-krit1	standard conditions	Fig. S6 from Gore et al., 2008
intersegmental vessel cell-cell junction assembly decreased process quality, abnormal	s843Tg + MO1-krit1	standard conditions	Fig. 8. from Lee et al., 2021
dorsal longitudinal anastomotic vessel cell-cell junction rasip1 expression decreased amount, abnormal	s843Tg + MO1-krit1	standard conditions	Fig. 8. from Lee et al., 2021
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal	s843Tg + MO1-krit1	standard conditions	Fig. 8. from Lee et al., 2021
dorsal longitudinal anastomotic vessel cell-cell junction rasip1 expression mislocalised, abnormal	s843Tg + MO1-krit1	standard conditions	Fig. 8. from Lee et al., 2021
caudal vein plexus sprouting angiogenesis increased occurrence, abnormal	s843Tg + MO1-krit1	standard conditions	Fig. 6, Fig. 7 from Mleynek et al., 2014
caudal vein plexus angiogenic sprout increased amount, abnormal	s843Tg + MO1-krit1	standard conditions	Fig. 6, Fig. 7 from Mleynek et al., 2014
blood vessel morphogenesis decreased process quality, abnormal	s843Tg + MO1-krit1	standard conditions	Fig. 6, Fig. 7 from Mleynek et al., 2014
post-vent vasculature morphology, abnormal	s843Tg + MO1-krit1	standard conditions	Fig. 6, Fig. 7 from Mleynek et al., 2014
angiogenesis process quality, abnormal	y1Tg + MO1-krit1 + MO2-krit1 (AB)	standard conditions	Fig. S3 from Liu et al., 2011
intersegmental vessel malformed, abnormal	y1Tg + MO1-krit1 + MO2-krit1 (AB)	standard conditions	Fig. S3 from Liu et al., 2011
heart increased size, abnormal	y1Tg + MO1-krit1 + MO2-krit1 (AB)	standard conditions	Fig. S3 from Liu et al., 2011
blood circulation process quality, abnormal	y1Tg + MO1-krit1 + MO2-krit1 (AB)	standard conditions	Fig. S3 from Liu et al., 2011
vascular endothelium apoptotic, abnormal	y1Tg + MO1-krit1 + MO2-krit1 (AB)	standard conditions	Fig. 4, Fig. 5 from Liu et al., 2010
blood vessel lumenization process quality, abnormal	y1Tg + MO1-krit1 + MO2-krit1 (AB)	standard conditions	Fig. S3 from Liu et al., 2011
intersegmental vessel unlumenized, abnormal	y1Tg + MO1-krit1 + MO2-krit1 (AB)	standard conditions	Fig. S3 from Liu et al., 2011
sinus venosus dilated, abnormal	TU + MO1-ccm2l + MO1-krit1	standard conditions	Fig. 4 from Rosen et al., 2013
blood circulation arrested, abnormal	TU + MO1-ccm2l + MO1-krit1	standard conditions	Fig. 4 from Rosen et al., 2013
atrium dilated, abnormal	TU + MO1-ccm2l + MO1-krit1	standard conditions	Fig. 4 from Rosen et al., 2013
sinus venosus dilated, abnormal	TU + MO1-krit1 + MO2-ccm2l	standard conditions	Fig. 4 from Rosen et al., 2013
blood circulation arrested, abnormal	TU + MO1-krit1 + MO2-ccm2l	standard conditions	Fig. 4 from Rosen et al., 2013
atrium dilated, abnormal	TU + MO1-krit1 + MO2-ccm2l	standard conditions	Fig. 4 from Rosen et al., 2013
intersegmental vessel cell-cell junction assembly decreased process quality, abnormal	ncv27Tg + MO1-krit1	standard conditions	Fig. 8. from Lee et al., 2021
intersegmental vessel sprouting angiogenesis decreased process quality, abnormal	ncv27Tg + MO1-krit1	standard conditions	Fig. 8. from Lee et al., 2021

Citations