Morpholino
MO2-atp1b1a
- ID
- ZDB-MRPHLNO-060622-5
- Name
- MO2-atp1b1a
- Previous Names
-
- [b]1aMO-2 (1)
- Target
- Sequence
-
5' - CGGTATTTAGTTCCCTTTTTGGTGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-atp1b1a
No data available
Phenotype
Phenotype resulting from MO2-atp1b1a
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO2-atp1b1a
1 - 5 of 15 Show all
Citations
- Hatzold, J., Nett, V., Brantsch, S., Zhang, J.L., Armistead, J., Wessendorf, H., Stephens, R., Humbert, P.O., Iden, S., Hammerschmidt, M. (2023) Matriptase-dependent epidermal pre-neoplasm in zebrafish embryos caused by a combination of hypotonic stress and epithelial polarity defects. PLoS Genetics. 19:e1010873e1010873
- Hatzold, J., Beleggia, F., Herzig, H., Altmüller, J., Nürnberg, P., Bloch, W., Wollnik, B., Hammerschmidt, M. (2016) Tumor suppression in basal keratinocytes via dual non-cell-autonomous functions of a Na,K-ATPase beta subunit. eLIFE. 5:e14277
- Lundby, A., Rossin, E.J., Steffensen, A.B., Acha, M.R., Newton-Cheh, C., Pfeufer, A., Lynch, S.N., QT Interval International GWAS Consortium (QT-IGC), Olesen, S.P., Brunak, S., Ellinor, P.T., Jukema, J.W., Trompet, S., Ford, I., Macfarlane, P.W., Krijthe, B.P., Hofman, A., Uitterlinden, A.G., Stricker, B.H., Nathoe, H.M., Spiering, W., Daly, M.J., Asselbergs, F.W., van der Harst, P., Milan, D.J., de Bakker, P.I., Lage, K., Olsen, J.V. (2014) Annotation of loci from genome-wide association studies using tissue-specific quantitative interaction proteomics. Nature Methods. 11(8):868-74
- Blasiole, B., Canfield, V.A., Vollrath, M.A., Huss, D., Mohideen, M.A., Dickman, J.D., Cheng, K.C., Fekete, D.M., and Levenson, R. (2006) Separate Na,K-ATPase genes are required for otolith formation and semicircular canal development in zebrafish. Developmental Biology. 294(1):148-160
1 - 4 of 4
Show