Morpholino

MO2-ctnnb1

ID

ZDB-MRPHLNO-060414-1

Name

MO2-ctnnb1

Previous Names

b-catenin-1 MO1 (1)

Target

ctnnb1 (1)

Sequence

5' - CTGGGTAGCCATGATTTTCTCACAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-ctnnb1

Expressed Gene	Anatomy	Figures
chrd	(not) axis (not) ectoderm germ ring margin (not) mesoderm (not) whole organism	Fig. 2 from Varga et al., 2007 Fig. 7 from Bellipanni et al., 2006
dharma	margin (not) whole organism	Fig. 5 , Fig. 7 from Bellipanni et al., 2006
egr2b	unspecified	Fig. 6 from Bellipanni et al., 2006
emx1	unspecified	Fig. 6 from Bellipanni et al., 2006
gsc	margin	Fig. 7 from Bellipanni et al., 2006
hoxb6b	unspecified	Fig. 6 from Bellipanni et al., 2006
isl1a	unspecified	Fig. 6 from Bellipanni et al., 2006
myod1	unspecified	Fig. 6 from Bellipanni et al., 2006
ndr1	margin	Fig. 5 , Fig. 7 from Bellipanni et al., 2006
nog1	(not) axial mesoderm germ ring	Fig. 2 from Varga et al., 2007

Phenotype

Phenotype resulting from MO2-ctnnb1

Phenotype	Fish	Figures
head necrotic, abnormal	WT + MO2-ctnnb1	Fig. 4 from Bellipanni et al., 2006
post-vent region curved ventral, abnormal	WT + MO2-ctnnb1	Fig. 4 from Bellipanni et al., 2006
post-vent region decreased length, abnormal	WT + MO2-ctnnb1	Fig. 4 from Bellipanni et al., 2006

Phenotype of all Fish created by or utilizing MO2-ctnnb1

Phenotype	Fish	Conditions	Figures
post-vent region decreased length, abnormal	WT + MO2-ctnnb1	standard conditions	Fig. 4 from Bellipanni et al., 2006
post-vent region curved ventral, abnormal	WT + MO2-ctnnb1	standard conditions	Fig. 4 from Bellipanni et al., 2006
head necrotic, abnormal	WT + MO2-ctnnb1	standard conditions	Fig. 4 from Bellipanni et al., 2006
whole organism morphology, ameliorated	ctnnb2^tpl149/+ + MO1-ctnnb2 + MO2-ctnnb1	standard conditions	Figure 2 from Cunningham et al., 2020
dorsal/ventral axis specification disrupted, abnormal	WT + MO1-ctnnb2 + MO2-ctnnb1	standard conditions	Fig. 6 from Bellipanni et al., 2006
whole organism wholly dorsalized, abnormal	WT + MO1-ctnnb2 + MO2-ctnnb1	standard conditions	Fig. 6 from Bellipanni et al., 2006
whole organism morphology, abnormal	WT + MO1-ctnnb2 + MO2-ctnnb1	standard conditions	Figure 2 from Cunningham et al., 2020
whole organism wholly dorsalized, abnormal	ctnnb2^p1 + MO2-ctnnb1	standard conditions	Fig. 6 from Bellipanni et al., 2006
dorsal/ventral axis specification disrupted, abnormal	ctnnb2^p1 + MO2-ctnnb1	standard conditions	Fig. 6 from Bellipanni et al., 2006
whole organism wholly ventralized, abnormal	brs^b2; ctnnb2^p1/p1 + MO1-ctnnb2 + MO2-ctnnb1	standard conditions	Fig. 3 from Varga et al., 2007
post-vent region morphology, abnormal	brs^b2; ctnnb2^p1/p1 + MO1-ctnnb2 + MO2-ctnnb1	standard conditions	Fig. 3 from Varga et al., 2007
post-vent region morphology, abnormal	brs^b2; ctnnb2^p1/p1 + MO1-chrd + MO1-ctnnb2 + MO2-ctnnb1	standard conditions	Fig. 3 from Varga et al., 2007
whole organism wholly ventralized, abnormal	brs^b2; ctnnb2^p1/p1 + MO1-chrd + MO1-ctnnb2 + MO2-ctnnb1	standard conditions	Fig. 3 from Varga et al., 2007

Citations