Morpholino
MO1-acvrl1
- ID
- ZDB-MRPHLNO-060411-3
- Name
- MO1-acvrl1
- Previous Names
- None
- Target
- Sequence
-
5' - CTGCGAGCATCACTGAAGCCTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets +3 to +25 of the coding region of acvrl1.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-acvrl1
No data available
Phenotype
Phenotype resulting from MO1-acvrl1
No data available
Phenotype of all Fish created by or utilizing MO1-acvrl1
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| central artery atretic, abnormal | WT + MO1-acvrl1 + MO2-acvrl1 | standard conditions |
Fig. 5 
from Roman et al., 2002 |
| cranial blood vessel dilated, abnormal | WT + MO1-acvrl1 + MO2-acvrl1 | standard conditions |
Fig. 5
from Roman et al., 2002 |
1 - 2 of 2
Citations
- Kim, J.D., Kim, J. (2014) Alk3/Alk3b and Smad5 Mediate BMP Signaling during Lymphatic Development in Zebrafish. Molecules and cells. 37:270-4
- Jadrich, J.L., O'connor, M.B., and Coucouvanis, E. (2006) The TGFβ activated kinase TAK1 regulates vascular development in vivo. Development (Cambridge, England). 133(8):1529-1541
- Roman, B.L., Pham, V., Lawson, N.D., Kulik, M., Childs, S., Lekven, A.C., Garrity, D.M., Moon, R.T., Fishman, M.C., Lechleider, R.J., and Weinstein, B.M. (2002) Disruption of acvrl1 increases endothelial cell number in zebrafish cranial vessels. Development (Cambridge, England). 129(12):3009-3019
1 - 3 of 3
Show