Morpholino
MO1-ptger2a
- ID
- ZDB-MRPHLNO-060302-1
- Name
- MO1-ptger2a
- Previous Names
- Target
- Sequence
-
5' - GATGTTGGCATGTTTGAGAGCATGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
translation blocker targeted to 5'-UTR
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptger2a
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| slc12a1 |
Fig. 4 
from Poureetezadi et al., 2016 |
|
| slc12a3 |
Fig. 4
from Poureetezadi et al., 2016 |
1 - 2 of 2
Phenotype
Phenotype resulting from MO1-ptger2a
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-ptger2a
1 - 5 of 31 Show all
Citations
- Poureetezadi, S.J., Cheng, C.N., Chambers, J.M., Drummond, B.E., Wingert, R.A. (2016) Prostaglandin signaling regulates nephron segment patterning of renal progenitors during zebrafish kidney development. eLIFE. 5
- Nissim, S., Sherwood, R.I., Wucherpfennig, J., Saunders, D., Harris, J.M., Esain, V., Carroll, K.J., Frechette, G.M., Kim, A.J., Hwang, K.L., Cutting, C.C., Elledge, S., North, T.E., and Goessling, W. (2014) Prostaglandin E2 regulates liver versus pancreas cell-fate decisions and endodermal outgrowth. Developmental Cell. 28(4):423-437
- North, T.E., Goessling, W., Walkley, C.R., Lengerke, C., Kopani, K.R., Lord, A.M., Weber, G.J., Bowman, T.V., Jang, I.H., Grosser, T., Fitzgerald, G.A., Daley, G.Q., Orkin, S.H., and Zon, L.I. (2007) Prostaglandin E2 regulates vertebrate haematopoietic stem cell homeostasis. Nature. 447(7147):1007-1011
- Cha, Y.I., Kim, S.H., Sepich, D., Buchanan, F.G., Solnica-Krezel, L., and Dubois, R.N. (2006) Cyclooxygenase-1-derived PGE2 promotes cell motility via the G-protein-coupled EP4 receptor during vertebrate gastrulation. Genes & Development. 20(1):77-86
1 - 4 of 4
Show