Morpholino
MO1-fgfr1a
- ID
- ZDB-MRPHLNO-060222-1
- Name
- MO1-fgfr1a
- Previous Names
-
- MO1-fgfr1
- Target
- Sequence
-
5' - GCAGCAGCGTGGTCTTCATTATCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fgfr1a
Expressed Gene | Anatomy | Figures |
---|---|---|
efna3b |
Fig. 10 ![]() |
|
enc3 |
Fig. 4 ![]() |
|
foxj1a |
Fig. 4 ![]() |
|
gnrh3 |
Fig. 7 ![]() |
|
mafa |
Fig. 10 ![]() |
1 - 5 of 5
Phenotype
Phenotype resulting from MO1-fgfr1a
1 - 5 of 9 Show all
Phenotype of all Fish created by or utilizing MO1-fgfr1a
1 - 5 of 15 Show all
Citations
- Dries, R., Lange, A., Heiny, S., Berghaus, K.I., Bastmeyer, M., Bentrop, J. (2021) Cell Proliferation and Collective Cell Migration During Zebrafish Lateral Line System Development Are Regulated by Ncam/Fgf-Receptor Interactions. Frontiers in cell and developmental biology. 8:591011
- Wu, Y., Huang, S., Zhao, H., Cao, K., Gan, J., Yang, C., Xu, Z., Li, S., Su, B. (2021) Zebrafish Minichromosome Maintenance Protein 5 Gene Regulates the Development and Migration of Facial Motor Neurons via Fibroblast Growth Factor Signaling. Developmental neuroscience. 43(2):84-94
- Gao, Q., Zhang, J., Wang, X., Liu, Y., He, R., Liu, X., Wang, F., Feng, J., Yang, D., Wang, Z., Meng, A., Yan, X. (2017) The signalling receptor MCAM coordinates apical-basal polarity and planar cell polarity during morphogenesis. Nature communications. 8:15279
- Hong, S., Hu, P., Marino, J., Hufnagel, S.B., Hopkin, R.J., Toromanović, A., Richieri-Costa, A., Ribeiro-Bicudo, L.A., Kruszka, P., Roessler, E., Muenke, M. (2016) Dominant-negative Kinase Domain Mutations in FGFR1 Can Explain the Clinical Severity of Hartsfield Syndrome. Human molecular genetics. 25(10):1912-1922
- Kuo, M.W., Lou, S.W., Chung, B.C. (2014) Hedgehog-PKA Signaling and gnrh3 Regulate the Development of Zebrafish gnrh3 Neurons. PLoS One. 9:e95545
- Lee, Y., Manegold, J.E., Kim, A.D., Pouget, C., Stachura, D.L., Clements, W.K., Traver, D. (2014) FGF signalling specifies haematopoietic stem cells through its regulation of somitic Notch signalling. Nature communications. 5:5583
- Garaffo, G., Provero, P., Molineris, I., Pinciroli, P., Peano, C., Battaglia, C., Tomaiuolo, D., Etzion, T., Gothilf, Y., Santoro, M., and Merlo, G.R. (2013) Profiling, Bioinformatic, and Functional Data on the Developing Olfactory/GnRH System Reveal Cellular and Molecular Pathways Essential for This Process and Potentially Relevant for the Kallmann Syndrome. Frontiers in Experimental Endocrinology. 4:203
- Larbuisson, A., Dalcq, J., Martial, J.A., and Muller, M. (2013) Fgf receptors Fgfr1a and Fgfr2 control the function of pharyngeal endoderm in late cranial cartilage development. Differentiation; research in biological diversity. 86(4-5):192-206
- Qian, M., Yao, S., Jing, L., He, J., Xiao, C., Zhang, T., Meng, W., Zhu, H., Xu, H., and Mo, X. (2013) ENC1-like Integrates the Retinoic Acid/FGF Signaling Pathways to Modulate Ciliogenesis of Kupffer's Vesicle during Zebrafish Embryonic Development. Developmental Biology. 374(1):85-95
- Samson, S.C., Ferrer, T., Jou, C.J., Sachse, F.B., Shankaran, S.S., Shaw, R.M., Chi, N.C., Tristani-Firouzi, M., and Yost, H.J. (2013) 3-OST-7 regulates BMP-dependent cardiac contraction. PLoS Biology. 11(12):e1001727
1 - 10 of 17
Show