Morpholino

MO1-dmd

ID

ZDB-MRPHLNO-060220-1

Name

MO1-dmd

Previous Names

None

Target

dmd (1)

Sequence

5' - TTGAGTCCTTTAATCCTACAATTTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This morpholino has a 1 bp mismatch to Ensembl sequence, which may be due to a polymorphism. Correspondence with author Guyon indicates that the published sequence of the morpholino is correct and that it matches the sequence of their cDNA.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dmd

Expressed Gene	Anatomy	Figures
dmd	(not) whole organism	Fig. 6 from Ruf-Zamojski et al., 2015

Phenotype

Phenotype resulting from MO1-dmd

Phenotype	Fish	Figures
muscle broken, abnormal	zf13Tg + MO1-dmd	Fig. 1 from Johnson et al., 2013

Phenotype of all Fish created by or utilizing MO1-dmd

Phenotype	Fish	Conditions	Figures
muscle broken, abnormal	dmd^{ta222a/ta222a} + MO1-dmd + MO6-dmd	standard conditions	Fig. 2 from Johnson et al., 2013
alpha-tubulin acetylation occurrence, ameliorated	AB + MO1-dmd + MO6-dmd	chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor	Fig. 5 from Spreafico et al., 2021
whole organism pax7b expression amount, ameliorated	AB + MO1-dmd + MO6-dmd	chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor	Fig. 2 from Spreafico et al., 2021
skeletal muscle lesioned, abnormal	AB + MO1-dmd + MO6-dmd	control	Fig. 2 from Spreafico et al., 2021
whole organism pax7b expression increased amount, abnormal	AB + MO1-dmd + MO6-dmd	control	Fig. 2 from Spreafico et al., 2021
whole organism mylpfa expression decreased amount, abnormal	AB + MO1-dmd + MO6-dmd	control	Fig. 2 from Spreafico et al., 2021
whole organism mylpfa expression amount, ameliorated	AB + MO1-dmd + MO6-dmd	chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor	Fig. 2 from Spreafico et al., 2021
skeletal muscle lesioned, ameliorated	AB + MO1-dmd + MO6-dmd	chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor	Fig. 2 from Spreafico et al., 2021
whole organism pax3b expression amount, ameliorated	AB + MO1-dmd + MO6-dmd	chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor	Fig. 2 from Spreafico et al., 2021
whole organism hdac8 expression increased amount, abnormal	AB + MO1-dmd + MO6-dmd	standard conditions	Fig. 2 from Spreafico et al., 2021
alpha-tubulin acetylation decreased occurrence, abnormal	AB + MO1-dmd + MO6-dmd	control	Fig. 5 from Spreafico et al., 2021
whole organism pax3a expression amount, ameliorated	AB + MO1-dmd + MO6-dmd	chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor	Fig. 2 from Spreafico et al., 2021
whole organism pax3a expression increased amount, abnormal	AB + MO1-dmd + MO6-dmd	control	Fig. 2 from Spreafico et al., 2021
whole organism pax7a expression amount, ameliorated	AB + MO1-dmd + MO6-dmd	chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor	Fig. 2 from Spreafico et al., 2021
whole organism pax3b expression increased amount, abnormal	AB + MO1-dmd + MO6-dmd	control	Fig. 2 from Spreafico et al., 2021
muscle cell increased width, abnormal	AB + MO1-dmd + MO6-dmd	control	Fig. 5 from Spreafico et al., 2021
whole organism pax7a expression increased amount, abnormal	AB + MO1-dmd + MO6-dmd	control	Fig. 2 from Spreafico et al., 2021
muscle cell increased width, ameliorated	AB + MO1-dmd + MO6-dmd	chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor	Fig. 5 from Spreafico et al., 2021
whole organism crebbpb expression decreased amount, abnormal	WT + MO1-dmd + MO6-dmd	standard conditions	Fig. 1 from Bajanca et al., 2017
somite border dmd expression absent, abnormal	WT + MO1-dmd + MO6-dmd	standard conditions	Fig. 1 from Bajanca et al., 2017
whole organism ep300b expression decreased amount, abnormal	WT + MO1-dmd + MO6-dmd	standard conditions	Fig. 1 from Bajanca et al., 2017
myotome broken, abnormal	WT + MO1-dmd + MO6-dmd	standard conditions	Fig. 3 from Johnson et al., 2013
whole organism ep300a expression decreased amount, abnormal	WT + MO1-dmd + MO6-dmd	standard conditions	Fig. 1 from Bajanca et al., 2017
skeletal muscle cell disorganized, abnormal	WT + MO1-dmd + MO6-dmd	standard conditions	Fig. 1 from Bajanca et al., 2017
muscle broken, abnormal	WT + MO1-dmd + MO6-dmd	standard conditions	Fig. 2 , Fig. 3 from Johnson et al., 2013
whole organism fstb expression decreased amount, abnormal	WT + MO1-dmd + MO6-dmd	chemical treatment by environment: trichostatin A	Fig. 1 from Bajanca et al., 2017
skeletal muscle cell organization quality, ameliorated	WT + MO1-dmd + MO6-dmd	chemical treatment by environment: trichostatin A	Fig. 1 from Bajanca et al., 2017
whole organism crebbpa expression decreased amount, abnormal	WT + MO1-dmd + MO6-dmd	chemical treatment by environment: trichostatin A	Fig. 1 from Bajanca et al., 2017
muscle broken, abnormal	zf13Tg + MO1-dmd	standard conditions	Fig. 1 from Johnson et al., 2013
muscle broken, abnormal	zf13Tg + MO1-dmd + MO6-dmd	standard conditions	Fig. 2 , Fig. 3 , Fig. 4 from Johnson et al., 2013
muscle broken, abnormal	zf13Tg + MO1-dmd + MO6-dmd	chemical treatment: pharmaceutical	Fig. 5 from Johnson et al., 2013
myotome broken, abnormal	zf13Tg + MO1-dmd + MO6-dmd	standard conditions	Fig. 3 , Fig. 4 from Johnson et al., 2013
myotome neutrophil amount, ameliorated	zf13Tg + MO1-dmd + MO6-dmd (AB)	chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor	Fig. 3 from Spreafico et al., 2021
myotome neutrophil increased amount, abnormal	zf13Tg + MO1-dmd + MO6-dmd (AB)	control	Fig. 3 from Spreafico et al., 2021

Citations