Morpholino
MO1-bbs5
- ID
- ZDB-MRPHLNO-060209-6
- Name
- MO1-bbs5
- Previous Names
-
- bbs5MetMO (1)
- Target
- Sequence
-
5' - GTCCAACACCGACGCCATGATCACT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bbs5
No data available
Phenotype
Phenotype resulting from MO1-bbs5
from 1 - 5 of 9 Show all
Phenotype of all Fish created by or utilizing MO1-bbs5
1 - 5 of 10 Show all
Citations
- Castro-Sánchez, S., Suarez-Bregua, P., Novas, R., Álvarez-Satta, M., Badano, J.L., Rotllant, J., Valverde, D. (2019) Functional analysis of new human Bardet-Biedl syndrome loci specific variants in the zebrafish model. Scientific Reports. 9:12936
- Zaghloul, N.A., Liu, Y., Gerdes, J.M., Gascue, C., Oh, E.C., Leitch, C.C., Bromberg, Y., Binkley, J., Leibel, R.L., Sidow, A., Badano, J.L., and Katsanis, N. (2010) Functional analyses of variants reveal a significant role for dominant negative and common alleles in oligogenic Bardet-Biedl syndrome. Proceedings of the National Academy of Sciences of the United States of America. 107(23):10602-10607
- Tayeh, M.K., Yen, H.J., Beck, J.S., Searby, C.C., Westfall, T.A., Griesbach, H., Sheffield, V.C., and Slusarski, D.C. (2008) Genetic interaction between Bardet-Biedl syndrome genes and implications for limb patterning. Human molecular genetics. 17(13):1956-1967
- Yen, H.J., Tayeh, M.K., Mullins, R.F., Stone, E.M., Sheffield, V.C., and Slusarski, D.C. (2006) Bardet-Biedl syndrome genes are important in retrograde intracellular trafficking and Kupffer's vesicle cilia function. Human molecular genetics. 15(5):667-677
1 - 4 of 4
Show