Morpholino

MO1-ccdc28b

ID
ZDB-MRPHLNO-060209-1
Name
MO1-ccdc28b
Previous Names
None
Target
Sequence
5' - ACTCTGTGCCATACCAAATGCCTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ccdc28b
No data available
Phenotype
Phenotype resulting from MO1-ccdc28b
Phenotype Fish Figures
cell detached from neural tube, abnormal WT + MO1-ccdc28b Fig. 3 from Badano et al., 2006
notochord increased width, abnormal WT + MO1-ccdc28b Fig. 3,  Fig. S4,  Fig. S7 from Badano et al., 2006
notochord kinked, abnormal WT + MO1-ccdc28b Fig. 3,  Fig. S4,  Fig. S7 from Badano et al., 2006
post-vent region morphology, abnormal WT + MO1-ccdc28b Fig. S4 from Badano et al., 2006
somite increased width, abnormal WT + MO1-ccdc28b Fig. S4,  Fig. S7 from Badano et al., 2006
somite shape, abnormal WT + MO1-ccdc28b Fig. 3,  Fig. S4 from Badano et al., 2006
somite border amorphous, abnormal WT + MO1-ccdc28b Fig. S4 from Badano et al., 2006
somite border morphology, abnormal WT + MO1-ccdc28b Fig. 3 from Badano et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-ccdc28b Fig. 3,  Fig. S4,  Fig. S7 from Badano et al., 2006
Phenotype of all Fish created by or utilizing MO1-ccdc28b
Phenotype Fish Conditions Figures
notochord increased width, abnormal WT + MO1-ccdc28b standard conditions Fig. 3,  Fig. S4,  Fig. S7 from Badano et al., 2006
somite shape, abnormal WT + MO1-ccdc28b standard conditions Fig. 3,  Fig. S4 from Badano et al., 2006
somite border amorphous, abnormal WT + MO1-ccdc28b standard conditions Fig. S4 from Badano et al., 2006
cell detached from neural tube, abnormal WT + MO1-ccdc28b standard conditions Fig. 3 from Badano et al., 2006
post-vent region morphology, abnormal WT + MO1-ccdc28b standard conditions Fig. S4 from Badano et al., 2006
notochord kinked, abnormal WT + MO1-ccdc28b standard conditions Fig. 3,  Fig. S4,  Fig. S7 from Badano et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-ccdc28b standard conditions Fig. 3,  Fig. S4,  Fig. S7 from Badano et al., 2006
somite increased width, abnormal WT + MO1-ccdc28b standard conditions Fig. S4,  Fig. S7 from Badano et al., 2006
somite border morphology, abnormal WT + MO1-ccdc28b standard conditions Fig. 3 from Badano et al., 2006
somite increased width, abnormal WT + MO1-bbs1 + MO1-ccdc28b standard conditions Fig. 4 from Badano et al., 2006
notochord increased width, abnormal WT + MO1-bbs1 + MO1-ccdc28b standard conditions Fig. 4 from Badano et al., 2006
notochord kinked, abnormal WT + MO1-bbs1 + MO1-ccdc28b standard conditions Fig. 4 from Badano et al., 2006
somite shape, abnormal WT + MO1-bbs1 + MO1-ccdc28b standard conditions Fig. 4 from Badano et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs1 + MO1-ccdc28b standard conditions Fig. 4 from Badano et al., 2006
somite border amorphous, abnormal WT + MO1-bbs1 + MO1-ccdc28b standard conditions Fig. 4 from Badano et al., 2006
notochord kinked, abnormal WT + MO1-bbs4 + MO1-ccdc28b standard conditions Fig. 3,  Fig. S7 from Badano et al., 2006
somite increased width, abnormal WT + MO1-bbs4 + MO1-ccdc28b standard conditions Fig. 3,  Fig. S7 from Badano et al., 2006
post-vent region morphology, abnormal WT + MO1-bbs4 + MO1-ccdc28b standard conditions Fig. S7 from Badano et al., 2006
somite border amorphous, abnormal WT + MO1-bbs4 + MO1-ccdc28b standard conditions Fig. S7 from Badano et al., 2006
cell detached from neural tube, abnormal WT + MO1-bbs4 + MO1-ccdc28b standard conditions Fig. 3 from Badano et al., 2006
somite shape, abnormal WT + MO1-bbs4 + MO1-ccdc28b standard conditions Fig. 3,  Fig. S7 from Badano et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs4 + MO1-ccdc28b standard conditions Fig. 3,  Fig. S7 from Badano et al., 2006
notochord increased width, abnormal WT + MO1-bbs4 + MO1-ccdc28b standard conditions Fig. 3,  Fig. S7 from Badano et al., 2006
somite border amorphous, abnormal WT + MO1-ccdc28b + MO1-mkks standard conditions Fig. S7 from Badano et al., 2006
notochord increased width, abnormal WT + MO1-ccdc28b + MO1-mkks standard conditions Fig. S7 from Badano et al., 2006
notochord kinked, abnormal WT + MO1-ccdc28b + MO1-mkks standard conditions Fig. S7 from Badano et al., 2006
post-vent region morphology, abnormal WT + MO1-ccdc28b + MO1-mkks standard conditions Fig. S7 from Badano et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-ccdc28b + MO1-mkks standard conditions Fig. S7 from Badano et al., 2006
somite increased width, abnormal WT + MO1-ccdc28b + MO1-mkks standard conditions Fig. S7 from Badano et al., 2006
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.