Morpholino
MO1-onecut1
- ID
- ZDB-MRPHLNO-051214-2
- Name
- MO1-onecut1
- Previous Names
-
- hnf-6 IE2 (1)
- Target
- Sequence
-
5' - TTCAGCGTGCAAACGAAAGGAGCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-onecut1
Expressed Gene | Anatomy | Figures |
---|---|---|
cp |
Fig. 7 ![]() |
|
vps33b |
Fig. 7 ![]() |
1 - 2 of 2
Phenotype
Phenotype resulting from MO1-onecut1
1 - 5 of 14 Show all
Phenotype of all Fish created by or utilizing MO1-onecut1
1 - 5 of 17 Show all
Citations
- Cui, S., Capecci, L.M., and Matthews, R.P. (2011) Disruption of planar cell polarity activity leads to developmental biliary defects. Developmental Biology. 351(2):229-241
- Matthews, R.P., Plumb-Rudewiez, N., Lorent, K., Gissen, P., Johnson, C.A., Lemaigre, F., and Pack, M. (2005) Zebrafish vps33b, an ortholog of the gene responsible for human arthrogryposis-renal dysfunction-cholestasis syndrome, regulates biliary development downstream of the onecut transcription factor hnf6. Development (Cambridge, England). 132(23):5295-5306
- Matthews, R.P., Lorent, K., Russo, P., and Pack, M. (2004) The zebrafish onecut gene hnf-6 functions in an evolutionarily conserved genetic pathway that regulates vertebrate biliary development. Developmental Biology. 274(2):245-259
1 - 3 of 3
Show