Morpholino

MO2-vegfc

ID
ZDB-MRPHLNO-051212-3
Name
MO2-vegfc
Previous Names
None
Target
Sequence
5' - AGACAGAAAATCCAAATAAGTGCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-vegfc
No data available
Phenotype
Phenotype resulting from MO2-vegfc
Phenotype of all Fish created by or utilizing MO2-vegfc
Phenotype Fish Conditions Figures
lymphangiogenesis disrupted, abnormal WT + MO1-vegfc + MO2-vegfc standard conditions Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal hu4453Tg + MO1-vegfc + MO2-vegfc standard conditions Fig. 2 from Hogan et al., 2009
trunk lymph vasculature aplastic, abnormal hu4453Tg + MO1-vegfc + MO2-vegfc standard conditions Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal y1Tg + MO1-vegfc + MO2-vegfc standard conditions Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal y1Tg + MO2-vegfc standard conditions Fig. 2 from Yaniv et al., 2007
thoracic duct lymphangiogenesis decreased process quality, abnormal y1Tg + MO2-vegfc standard conditions Fig. 4 with image from Cohen et al., 2020
trunk lacks all parts of type thoracic duct, abnormal y1Tg + MO2-vegfc standard conditions Fig. 4 with image from Cohen et al., 2020
primordial hindbrain channel angiogenesis decreased process quality, abnormal y1Tg + MO2-vegfc standard conditions Fig. 2 with image from Cohen et al., 2020
vascular lymphangioblast decreased amount, abnormal y1Tg + MO2-vegfc standard conditions Fig. 2 from Cermenati et al., 2013
posterior cardinal vein vascular sprouts decreased amount, abnormal y1Tg + MO2-vegfc standard conditions Fig. 2 from Cermenati et al., 2013
trunk has fewer parts of type vascular lymphangioblast, abnormal y1Tg + MO2-vegfc standard conditions Fig. 3 with image from Cohen et al., 2020
trunk lymphatic endothelial cell differentiation decreased occurrence, abnormal y1Tg + MO2-vegfc standard conditions Fig. 3 with image from Cohen et al., 2020
cranial blood vessel lacks all parts of type primordial hindbrain channel, abnormal y1Tg + MO2-vegfc standard conditions Fig. 2 with image from Cohen et al., 2020
thoracic duct aplastic, abnormal y1Tg + MO2-vegfc standard conditions Fig. 2 from Yaniv et al., 2007
artery aplastic, abnormal y1Tg + MO1-vegfc + MO2-vegfc + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal y1Tg + MO1-vegfc + MO2-vegfc + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
intersegmental vessel aplastic, abnormal y1Tg + MO1-vegfc + MO2-vegfc + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
posterior cardinal vein intersegmental vein decreased amount, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 5 from Cermenati et al., 2013
thoracic duct aplastic, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 4 from Cermenati et al., 2013
trunk intersegmental vein decreased amount, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 5 from Cermenati et al., 2013
posterior cardinal vein vascular lymphangioblast decreased amount, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 5Fig. 6 from Cermenati et al., 2013
horizontal myoseptum vascular lymphangioblast decreased amount, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 5 from Cermenati et al., 2013
posterior cardinal vein vascular sprouts decreased amount, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 5 from Cermenati et al., 2013
posterior cardinal vein vascular lymphangioblast absent, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 6 from Cermenati et al., 2013
lymphangiogenesis disrupted, abnormal hu4624Tg; s916Tg + MO1-vegfc + MO2-vegfc standard conditions Fig. 2 from Hogan et al., 2009
angiogenesis disrupted, abnormal hu4624Tg; s916Tg + MO1-vegfc + MO2-vegfc standard conditions Fig. 2 from Hogan et al., 2009
thoracic duct decreased amount, abnormal sox18sa12315/+; y1Tg + MO2-vegfc standard conditions Figure 3 with image from Moleri et al., 2023
lymphangiogenesis disrupted, abnormal sox18sa12315/+; y1Tg + MO2-vegfc standard conditions Figure 3 with image from Moleri et al., 2023
thoracic duct hypoplastic, abnormal sox18sa12315/+; y1Tg + MO2-vegfc standard conditions Figure 3 with image from Moleri et al., 2023
thoracic duct malformed, abnormal sox18sa12315/+; y1Tg + MO2-vegfc standard conditions Figure 3 with image from Moleri et al., 2023
thoracic duct hypoplastic, exacerbated sox18sa12315/sa12315; y1Tg + MO2-vegfc standard conditions Figure 3 with image from Moleri et al., 2023
thoracic duct decreased amount, exacerbated sox18sa12315/sa12315; y1Tg + MO2-vegfc standard conditions Figure 3 with image from Moleri et al., 2023
lymphangiogenesis disrupted, exacerbated sox18sa12315/sa12315; y1Tg + MO2-vegfc standard conditions Figure 3 with image from Moleri et al., 2023
Citations