Morpholino

MO1-axin1

ID

ZDB-MRPHLNO-050923-2

Name

MO1-axin1

Previous Names

axin1 MO (1)

Target

axin1 (1)

Sequence

5' - CATAGTGTCCCTGCACTCTGTCCCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This is a translation blocking morpholino targeting the gene axin1.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-axin1

No data available

Phenotype

Phenotype resulting from MO1-axin1

Phenotype	Fish	Figures
heart linear, abnormal	AB + MO1-axin1	Fig. S2 from Lee et al., 2007
heart looping disrupted, abnormal	AB + MO1-axin1	Fig. S2 from Lee et al., 2007

Phenotype of all Fish created by or utilizing MO1-axin1

Phenotype	Fish	Conditions	Figures
heart linear, abnormal	AB + MO1-axin1	standard conditions	Fig. S2 from Lee et al., 2007
heart looping disrupted, abnormal	AB + MO1-axin1	standard conditions	Fig. S2 from Lee et al., 2007
pericardium edematous, abnormal	AB + MO1-axin1 + MO1-gsk3ab	standard conditions	Fig. 2 from Lee et al., 2007
heart morphogenesis disrupted, abnormal	AB + MO1-axin1 + MO1-gsk3ab	standard conditions	Fig. 2 from Lee et al., 2007
whole organism anterior-posterior axis deformed, abnormal	AB + MO1-axin1 + MO1-gsk3ab	standard conditions	Fig. 2 from Lee et al., 2007
head degenerate, abnormal	AB + MO1-axin1 + MO1-gsk3ab	standard conditions	Fig. 2 from Lee et al., 2007
head apoptotic, abnormal	AB + MO1-axin1 + MO1-gsk3ab	standard conditions	Fig. 4 from Lee et al., 2007
heart linear, abnormal	AB + MO1-axin1 + MO1-gsk3ab	standard conditions	Fig. 2 from Lee et al., 2007
heart cardiac muscle cell decreased amount, abnormal	AB + MO1-axin1 + MO1-gsk3ab	standard conditions	Fig. 4 from Lee et al., 2007
whole organism anterior-posterior axis apoptotic, abnormal	AB + MO1-axin1 + MO1-gsk3ab	standard conditions	Fig. 4 from Lee et al., 2007
heart cardiac muscle cell decreased amount, abnormal	twu34Tg + MO1-axin1 + MO1-gsk3ab	standard conditions	Fig. 4 from Lee et al., 2007
heart morphogenesis disrupted, abnormal	twu34Tg + MO1-axin1 + MO1-gsk3ab	standard conditions	Fig. 3 from Lee et al., 2007
heart looping disrupted, abnormal	twu34Tg + MO1-axin1 + MO1-gsk3ab	standard conditions	Fig. 3 from Lee et al., 2007
primitive heart tube linear, abnormal	twu34Tg + MO1-axin1 + MO1-gsk3ab	standard conditions	Fig. 3 from Lee et al., 2007
heart cardiac muscle cell apoptotic, abnormal	twu34Tg + MO1-axin1 + MO1-gsk3ab	standard conditions	Fig. 4 from Lee et al., 2007
heart development delayed, abnormal	twu34Tg + MO1-axin1 + MO1-gsk3ab	standard conditions	Fig. 3 , Fig. 4 from Lee et al., 2007

Citations