Morpholino

MO1-lmx1bb

ID
ZDB-MRPHLNO-050824-3
Name
MO1-lmx1bb
Previous Names
  • lmx1b.1-ATG (1)
  • MO1-lmx1b.1
Target
Sequence
5' - CTTCGATTTTTATACCGTCCAACAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lmx1bb
Expressed Gene Anatomy Figures
wnt1 text only from O'Hara et al., 2005
Phenotype
Phenotype resulting from MO1-lmx1bb
Phenotype Fish Figures
heart edematous, abnormal ki1Tg + MO1-lmx1bb Fig. 3 from He et al., 2014
optokinetic behavior decreased occurrence, abnormal AB + MO1-lmx1bb Fig. 6 with image from Wang et al., 2019
optokinetic behavior decreased process quality, abnormal AB + MO1-lmx1bb Fig. 6 with image from Wang et al., 2019
podocyte development decreased process quality, abnormal AB + MO1-lmx1bb Fig. 4 from He et al., 2014
pronephric glomerular capillary increased diameter, abnormal AB + MO1-lmx1bb Fig. 4 from He et al., 2014
pronephric glomerulus lacks all parts of type pronephric podocyte slit diaphragm, abnormal AB + MO1-lmx1bb Fig. 4 from He et al., 2014
pronephric glomerulus physical object quality, abnormal ki1Tg + MO1-lmx1bb Fig. 3 from He et al., 2014
pronephric podocyte cell projection malformed, abnormal AB + MO1-lmx1bb Fig. 4 from He et al., 2014
Phenotype of all Fish created by or utilizing MO1-lmx1bb
Phenotype Fish Conditions Figures
podocyte development decreased process quality, abnormal AB + MO1-lmx1bb standard conditions Fig. 4 from He et al., 2014
pronephric glomerulus lacks all parts of type pronephric podocyte slit diaphragm, abnormal AB + MO1-lmx1bb standard conditions Fig. 4 from He et al., 2014
optokinetic behavior decreased occurrence, abnormal AB + MO1-lmx1bb standard conditions Fig. 6 with image from Wang et al., 2019
optokinetic behavior decreased process quality, abnormal AB + MO1-lmx1bb standard conditions Fig. 6 with image from Wang et al., 2019
pronephric glomerular capillary increased diameter, abnormal AB + MO1-lmx1bb standard conditions Fig. 4 from He et al., 2014
pronephric podocyte cell projection malformed, abnormal AB + MO1-lmx1bb standard conditions Fig. 4 from He et al., 2014
pronephric glomerulus physical object quality, abnormal ki1Tg + MO1-lmx1bb standard conditions Fig. 3 from He et al., 2014
heart edematous, abnormal ki1Tg + MO1-lmx1bb standard conditions Fig. 3 from He et al., 2014
cerebellum aplastic, abnormal TL + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 4 with image from O'Hara et al., 2005
pericardium edematous, abnormal TL + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 4 with image from O'Hara et al., 2005
blood circulation disrupted, abnormal TL + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 4 with image from O'Hara et al., 2005
hindbrain apoptotic, abnormal TL + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 7 with image from O'Hara et al., 2005
midbrain hindbrain boundary aplastic, abnormal TL + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 4 with image from O'Hara et al., 2005
diencephalon has fewer parts of type dopaminergic neuron, abnormal WT + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 6 with image from Filippi et al., 2007
brain dopaminergic neuron mislocalised, abnormal WT + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 6 with image from Filippi et al., 2007
area postrema has fewer parts of type dopaminergic neuron, abnormal WT + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 6 with image from Filippi et al., 2007
diencephalon dopaminergic neuron mislocalised laterally, abnormal WT + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 6 with image from Filippi et al., 2007
pronephric glomerulus physical object quality, abnormal ki1Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 3 from He et al., 2014
heart edematous, abnormal ki1Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 3 from He et al., 2014
pronephric glomerulus physical object quality, abnormal ki1Tg + MO1-lmx1bb + MO2-foxc1a standard conditions Fig. 3 from He et al., 2014
heart edematous, abnormal ki1Tg + MO1-lmx1bb + MO2-foxc1a standard conditions Fig. 3 from He et al., 2014
whole organism edematous, abnormal li1Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
pronephric glomerulus cystic, abnormal li1Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
heart edematous, abnormal li1Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
pronephric glomerulus morphogenesis process quality, abnormal li1Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
post-vent region coiled, abnormal li1Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
trunk curved, abnormal li1Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
pronephric glomerulus split bilaterally, abnormal li1Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
oculomotor nucleus aplastic, abnormal rw0Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 7 with image from O'Hara et al., 2005
trochlear motor nucleus aplastic, abnormal rw0Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 7 with image from O'Hara et al., 2005
post-vent region coiled, abnormal li1Tg + MO1-abrab + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
pronephric glomerulus split bilaterally, abnormal li1Tg + MO1-abrab + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
pronephric glomerulus cystic, abnormal li1Tg + MO1-abrab + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
trunk curved, abnormal li1Tg + MO1-abrab + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
heart edematous, abnormal li1Tg + MO1-abrab + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
whole organism edematous, abnormal li1Tg + MO1-abrab + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
pronephric glomerulus morphogenesis process quality, abnormal li1Tg + MO1-abrab + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
pronephros lacks all parts of type pronephric glomerulus, abnormal li1Tg + MO1-abrab + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.