Morpholino

MO1-fn1a

ID
ZDB-MRPHLNO-050620-2
Name
MO1-fn1a
Previous Names
  • MO1-fn1
Target
Sequence
5' - TTTTTTCACAGGTGCGATTGAACAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fn1a
No data available
Phenotype
Phenotype resulting from MO1-fn1a
Phenotype Fish Figures
endoderm increased width, abnormal ha01Tg + MO1-fn1a + MO4-tp53 Fig. S6 with image from Hu et al., 2018
Phenotype of all Fish created by or utilizing MO1-fn1a
Phenotype Fish Conditions Figures
endoderm increased width, abnormal ha01Tg + MO1-fn1a + MO4-tp53 standard conditions Fig. S6 with image from Hu et al., 2018
lateral rectus tissue regeneration delayed, abnormal zf13Tg + MO1-fn1a ablation: lateral rectus Fig. 6 with image from Louie et al., 2017
lateral rectus tissue regeneration decreased efficacy, abnormal zf13Tg + MO1-fn1a ablation: lateral rectus Fig. 6 with image from Louie et al., 2017
pharyngeal arch 1 decreased length, abnormal s1pr1ko311/ko311 + MO1-fn1a standard conditions Fig. 3 with image from Hisano et al., 2013
pharyngeal arch 1 decreased length, abnormal s1pr2ko322/ko322 + MO1-fn1a standard conditions Fig. 3 with image from Hisano et al., 2013
ventral mandibular arch disorganized, abnormal s1pr2ko322/ko322 + MO1-fn1a standard conditions Fig. 3 with image from Hisano et al., 2013
myotome myosin filament disorganized, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image from Snow et al., 2008
myotome actin filament increased length, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 2 with image,  Fig. 3 with image from Snow et al., 2008
myotome variant shape, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image,  Fig. 2 with image from Snow et al., 2008
somite border aplastic, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image from Snow et al., 2008
somitogenesis disrupted, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image from Snow et al., 2008
myotome actin filament disorganized, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 4 with image from Snow et al., 2008
somite border shape, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image,  Fig. 2 with image from Snow et al., 2008
myotome muscle tendon junction morphology, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 2 with image from Snow et al., 2008
somite shape, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image from Snow et al., 2008
skeletal muscle fiber development disrupted, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 2 with image,  Fig. 3 with image from Snow et al., 2008
myotome increased size, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image from Snow et al., 2008
endoderm increased width, abnormal ha01Tg + MO1-fn1a + MO1-lamb1a + MO4-tp53 standard conditions Fig. 6 with image,  Fig. S6 with image from Hu et al., 2018
endoderm increased width, abnormal ha01Tg + MO1-fn1a + MO4-tp53 + MO5-lama1 standard conditions Fig. S6 with image from Hu et al., 2018
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal ncv2Tg + MO1-fn1a + MO1-fn1b control Fig. 6 with image from Rho et al., 2019
ventral wall of dorsal aorta myb expression decreased amount, abnormal ncv2Tg + MO1-fn1a + MO1-fn1b control Fig. 6 with image from Rho et al., 2019
somite border ab2-fn labeling absent, abnormal ncv2Tg + MO1-fn1a + MO1-fn1b control Fig. 5 with image from Rho et al., 2019
angioblast cell migration from lateral mesoderm to midline process quality, abnormal ncv2Tg + MO1-fn1a + MO1-fn1b control Fig. 5 with image from Rho et al., 2019
posterior lateral plate mesoderm cell morphology, abnormal ncv2Tg + MO1-fn1a + MO1-fn1b control Fig. 5 with image from Rho et al., 2019
angioblast cell migration from lateral mesoderm to midline process quality, abnormal y1Tg + MO1-fn1a + MO1-fn1b control Fig. 5 with image from Rho et al., 2019
posterior lateral plate mesoderm cell decreased adhesivity, abnormal hzm7Et; ncv2Tg + MO1-fn1a + MO1-fn1b control Fig. 5 with image from Rho et al., 2019
heart primordium mislocalised laterally, abnormal s1pr2ko322/ko322; ko07Tg + MO1-fn1a standard conditions Fig. 3 with image from Hisano et al., 2013
cardioblast migration to the midline involved in heart rudiment formation absent, abnormal s1pr2ko322/ko322; ko07Tg + MO1-fn1a standard conditions Fig. 3 with image from Hisano et al., 2013
cardioblast migration to the midline involved in heart rudiment formation disrupted, abnormal s1pr2ko322/ko322; ko07Tg + MO1-fn1a standard conditions Fig. 3 with image from Hisano et al., 2013
heart rudiment increased amount, abnormal s1pr2ko322/ko322; ko07Tg + MO1-fn1a standard conditions Fig. 3 with image from Hisano et al., 2013
endoderm increased width, ameliorated gpc4fr6/fr6; ha01Tg + MO1-fn1a + MO1-lamb1a + MO4-tp53 standard conditions Fig. 6 with image from Hu et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.