Morpholino
MO2-scube2
- ID
- ZDB-MRPHLNO-050510-1
- Name
- MO2-scube2
- Previous Names
-
- you MO (1)
- Target
- Sequence
-
5' - GCCGTACAGTCCAAACAGCTCCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targeted to translational initiation site.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-scube2
Expressed Gene | Anatomy | Figures |
---|---|---|
myod1 |
Fig. 4 ![]() |
1 - 1 of 1
Phenotype
Phenotype resulting from MO2-scube2
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO2-scube2
1 - 4 of 4
Citations
- Corallo, D., Schiavinato, A., Trapani, V., Moro, E., Argenton, F., and Bonaldo, P. (2013) Emilin3 is required for notochord sheath integrity and interacts with Scube2 to regulate notochord-derived Hedgehog signals. Development (Cambridge, England). 140(22):4594-4601
- Johnson, J.L., Hall, T.E., Dyson, J.M., Sonntag, C., Ayers, K., Berger, S., Gautier, P., Mitchell, C., Hollway, G.E., and Currie, P.D. (2012) Scube activity is necessary for Hedgehog signal transduction in vivo. Developmental Biology. 368(2):193-202
- Hollway, G.E., Maule, J., Gautier, P., Evans, T.M., Keenan, D.G., Lohs, C., Fischer, D., Wicking, C., and Currie, P.D. (2006) Scube2 mediates Hedgehog signalling in the zebrafish embryo. Developmental Biology. 294(1):104-118
- Woods, I.G., and Talbot, W.S. (2005) The you Gene Encodes an EGF-CUB Protein Essential for Hedgehog Signaling in Zebrafish. PLoS Biology. 3(3):e66
1 - 4 of 4
Show