Morpholino

MO1-wnt11

ID

ZDB-MRPHLNO-050318-4

Name

MO1-wnt11

Previous Names

MO1-wnt11r
wnt11r-MO (1)

Target

wnt11 (1)

Sequence

5' - AGGGAAGGTTCGCTTCATGCTGTAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This is a translation blocking morpholino targeting the translation start site of wnt11r.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-wnt11

No data available

Phenotype

Phenotype resulting from MO1-wnt11

Phenotype	Fish	Figures
convergent extension disrupted, abnormal	AB + MO1-wnt11	Fig. Table 2 from Matsui et al., 2005

Phenotype of all Fish created by or utilizing MO1-wnt11

Phenotype	Fish	Conditions	Figures
convergent extension disrupted, abnormal	AB + MO1-wnt11	standard conditions	Fig. Table 2 from Matsui et al., 2005
heart tube bifurcated, abnormal	AB + MO1-wnt11 + MO1-wnt4	standard conditions	Fig. Table 2 from Matsui et al., 2005
convergent extension disrupted, abnormal	AB + MO1-wnt11 + MO1-wnt4	standard conditions	Fig. Table 2 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal	AB + MO1-wnt11 + MO1-wnt4	standard conditions	Fig. Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal	AB + MO1-wnt11 + MO1-wnt4	standard conditions	Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal	AB + MO1-wnt11 + MO2-wnt11f2	standard conditions	Fig. Table 2 from Matsui et al., 2005
heart tube bifurcated, abnormal	AB + MO1-wnt11 + MO2-wnt11f2	standard conditions	Fig. Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal	AB + MO1-wnt11 + MO2-wnt11f2	standard conditions	Fig. 3 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal	AB + MO1-wnt11 + MO2-wnt11f2	standard conditions	Fig. Table 2 from Matsui et al., 2005
intestinal bulb duplicated, abnormal	AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2	standard conditions	Fig. 5 from Matsui et al., 2005
heart tube bifurcated, abnormal	AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2	standard conditions	Fig. Table 2 from Matsui et al., 2005
convergent extension involved in organogenesis disrupted, abnormal	AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2	standard conditions	Fig. 5 from Matsui et al., 2005
convergent extension disrupted, abnormal	AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2	standard conditions	Fig. Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal	AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2	standard conditions	Fig. 3 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal	AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2	standard conditions	Fig. Table 2 from Matsui et al., 2005
pancreatic bud duplicated, abnormal	AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2	standard conditions	Fig. 5 from Matsui et al., 2005
convergent extension disrupted, abnormal	twu34Tg + MO1-wnt11 + MO1-wnt4	standard conditions	Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal	twu34Tg + MO1-wnt11 + MO2-wnt11f2	standard conditions	Fig. 3 from Matsui et al., 2005
heart tube bifurcated, abnormal	twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2	standard conditions	Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal	twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2	standard conditions	Fig. 3 from Matsui et al., 2005
whole organism apoptotic, abnormal	twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2	standard conditions	Fig. 3 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal	twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2	standard conditions	Fig. 3 from Matsui et al., 2005

Citations