Morpholino
MO1-cyp26a1
- ID
- ZDB-MRPHLNO-050316-1
- Name
- MO1-cyp26a1
- Previous Names
- None
- Target
- Sequence
-
5' - CGCGCAACTGATCGCCAAAACGAAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cyp26a1
Expressed Gene | Anatomy | Figures |
---|---|---|
dlc |
Fig. 7
from Echeverri et al., 2007 |
|
egr2b |
Fig. 3 ![]() |
|
her1 |
Fig. 7
from Echeverri et al., 2007 |
|
her7 |
Fig. 7
from Echeverri et al., 2007 |
|
myod1 |
Fig. 3 ![]() |
1 - 5 of 18 Show all
Phenotype
Phenotype resulting from MO1-cyp26a1
1 - 5 of 23 Show all
Phenotype of all Fish created by or utilizing MO1-cyp26a1
1 - 5 of 24 Show all
Citations
- Li, J., Zhao, Y., He, L., Huang, Y., Yang, X., Yu, L., Zhao, Q., Dong, X. (2018) Znfl1s are essential for patterning the anterior-posterior axis of zebrafish posterior hindbrain by acting as direct target genes of retinoic acid. Mechanisms of Development. 155:27-33
- Naylor, R.W., Skvarca, L.B., Thisse, C., Thisse, B., Hukriede, N.A., Davidson, A.J. (2016) BMP and retinoic acid regulate anterior-posterior patterning of the non-axial mesoderm across the dorsal-ventral axis. Nature communications. 7:12197
- Sosnik, J., Zheng, L., Rackauckas, C.V., Digman, M., Gratton, E., Nie, Q., Schilling, T.F. (2016) Noise modulation in retinoic acid signaling sharpens segmental boundaries of gene expression in the embryonic zebrafish hindbrain. eLIFE. 5:e14034
- Drummond, D.L., Cheng, C.S., Selland, L.G., Hocking, J.C., Prichard, L.B., and Waskiewicz, A.J. (2013) The role of Zic transcription factors in regulating hindbrain retinoic acid signaling. BMC Developmental Biology. 13:31
- Liang, D., Jia, W., Li, J., Li, K., and Zhao, Q. (2012) Retinoic Acid signaling plays a restrictive role in zebrafish primitive myelopoiesis. PLoS One. 7(2):e30865
- Kinkel, M.D., Sefton, E.M., Kikuchi, Y., Mizoguchi, T., Ward, A.B., and Prince, V.E. (2009) Cyp26 enzymes function in endoderm to regulate pancreatic field size. Proceedings of the National Academy of Sciences of the United States of America. 106(19):7864-7869
- Echeverri, K., and Oates, A.C. (2007) Coordination of symmetric cyclic gene expression during somitogenesis by Suppressor of Hairless involves regulation of retinoic acid catabolism. Developmental Biology. 301(2):388-403
- White, R.J., Nie, Q., Lander, A.D., and Schilling, T.F. (2007) Complex Regulation of cyp26a1 Creates a Robust Retinoic Acid Gradient in the Zebrafish Embryo. PLoS Biology. 5(11):e304
- Emoto, Y., Wada, H., Okamoto, H., Kudo, A., and Imai, Y. (2005) Retinoic acid-metabolizing enzyme Cyp26a1 is essential for determining territories of hindbrain and spinal cord in zebrafish. Developmental Biology. 278(2):415-427
1 - 9 of 9
Show