Morpholino
MO1-ptch2
- ID
- ZDB-MRPHLNO-050308-1
- Name
- MO1-ptch2
- Previous Names
-
- MO1-ptc1
- ptc1 MO1 (1)
- Target
- Sequence
-
5' - CATAGTCCAAACGGGAGGCAGAAGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptch2
Expressed Gene | Anatomy | Figures |
---|---|---|
foxa |
Fig. EV5
from Pan et al., 2017 Fig. 3 from Zhang et al., 2013 |
|
gli1 |
Fig. 4
from Pan et al., 2017 |
|
hhip |
Fig. EV5
from Pan et al., 2017 Fig. 3 from Zhang et al., 2013 |
|
myod1 |
Fig. 7 ![]() |
|
nkx2.2b |
Fig. 4
from Pan et al., 2017 |
1 - 5 of 9 Show all
Phenotype
Phenotype resulting from MO1-ptch2
1 - 5 of 24 Show all
Phenotype of all Fish created by or utilizing MO1-ptch2
1 - 5 of 45 Show all
Citations
- Hong, S., Hu, P., Jang, J.H., Carrington, B., Sood, R., Berger, S.I., Roessler, E., Muenke, M. (2020) Functional analysis of Sonic Hedgehog variants associated with holoprosencephaly in humans using a CRISPR/Cas9 zebrafish model. Human Mutation. 41(12):2155-2166
- Nagai-Tanima, M., Hong, S., Hu, P., Carrington, B., Sood, R., Roessler, E., Muenke, M. (2020) Rare hypomorphic human variation in the heptahelical domain of SMO contributes to holoprosencephaly phenotypes. Human Mutation. 41(12):2105-2118
- Pan, C., Xiong, Y., Lv, X., Xia, Y., Zhang, S., Chen, H., Fan, J., Wu, W., Liu, F., Wu, H., Zhou, Z., Zhang, L., Zhao, Y. (2017) UbcD1 regulates Hedgehog signaling by directly modulating Ci ubiquitination and processing. EMBO reports. 18:1922-1934
- Zhang, Z., Feng, J., Pan, C., Lv, X., Wu, W., Zhou, Z., Liu, F., Zhang, L., and Zhao, Y. (2013) Atrophin-Rpd3 complex represses Hedgehog signaling by acting as a corepressor of CiR. The Journal of cell biology. 203(4):575-583
- Stückemann, T., Wegleiter, T., Stefan, E., Nägele, O., Tarbashevich, K., Böck, G., Raz, E., and Aanstad, P. (2012) Zebrafish Cxcr4a determines the proliferative response to Hedgehog signalling. Development (Cambridge, England). 139(15):2711-2720
- Wilson, C.W., Nguyen, C.T., Chen, M.H., Yang, J.H., Gacayan, R., Huang, J., Chen, J.N., and Chuang, P.T. (2009) Fused has evolved divergent roles in vertebrate Hedgehog signalling and motile ciliogenesis. Nature. 459(7243):98-102
- Lee, J., Willer, J.R., Willer, G.B., Smith, K., Gregg, R.G., and Gross, J.M. (2008) Zebrafish blowout provides genetic evidence for Patched1-mediated negative regulation of Hedgehog signaling within the proximal optic vesicle of the vertebrate eye. Developmental Biology. 319(1):10-22
- Beales, P.L., Bland, E., Tobin, J.L., Bacchelli, C., Tuysuz, B., Hill, J., Rix, S., Pearson, C.G., Kai, M., Hartley, J., Johnson, C., Irving, M., Elcioglu, N., Winey, M., Tada, M., and Scambler, P.J. (2007) IFT80, which encodes a conserved intraflagellar transport protein, is mutated in Jeune asphyxiating thoracic dystrophy. Nature Genetics. 39(6):727-729
- Cerda, G.A., Thomas, J.E., Allende, M.L., Karlstrom, R.O., and Palma, V. (2006) Electroporation of DNA, RNA, and morpholinos into zebrafish embryos. Methods (San Diego, Calif.). 39(3):207-211
- Ochi, H., Pearson, B.J., Chuang, P.T., Hammerschmidt, M., and Westerfield, M. (2006) Hhip regulates zebrafish muscle development by both sequestering Hedgehog and modulating localization of Smoothened. Developmental Biology. 297(1):127-140
1 - 10 of 12
Show