Morpholino

MO3-dlx4b

ID
ZDB-MRPHLNO-050209-12
Name
MO3-dlx4b
Previous Names
None
Target
Sequence
5' - TGATGGATATTTACCTGTGTTTGCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
A splice blocking morpholino targeting the exon2/intron 2 splice site of dlx4b.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-dlx4b
No data available
Phenotype
Phenotype resulting from MO3-dlx4b
No data available
Phenotype of all Fish created by or utilizing MO3-dlx4b
Phenotype Fish Conditions Figures
Meckel's cartilage deformed, abnormal WT + MO2-dlx4b + MO3-dlx4b standard conditions Fig. 7 from Wu et al., 2015
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO2-dlx4b + MO3-dlx4b standard conditions Fig. 7 from Wu et al., 2015
Meckel's cartilage decreased width, abnormal WT + MO2-dlx4b + MO3-dlx4b standard conditions Fig. 7 from Wu et al., 2015
Meckel's cartilage decreased distance ceratohyal cartilage, abnormal WT + MO2-dlx4b + MO3-dlx4b standard conditions Fig. 7 from Wu et al., 2015
neurocranium decreased size, abnormal WT + MO2-dlx4b + MO3-dlx4b standard conditions Fig. 7 from Wu et al., 2015
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO2-dlx4b + MO3-dlx4b standard conditions Fig. 7 from Wu et al., 2015
neurocranium morphology, abnormal WT + MO2-dlx4b + MO3-dlx4b standard conditions Fig. 7 from Wu et al., 2015
trigeminal ganglion neuron decreased amount, abnormal AB/TL + MO3-dlx4b + MO4-dlx3b standard conditions Fig. 3 with image from Kaji et al., 2004
trigeminal placode neurod1 expression decreased amount, abnormal AB/TL + MO3-dlx4b + MO4-dlx3b standard conditions Fig. 3 with image from Kaji et al., 2004
Rohon-Beard neuron decreased amount, abnormal AB/TL + MO3-dlx4b + MO4-dlx3b standard conditions Fig. 2 with image from Kaji et al., 2004
opercle fused with branchiostegal ray, abnormal AB + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b standard conditions Fig. 1 with image from Talbot et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal AB + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b standard conditions Fig. 1 with image from Talbot et al., 2010
palatoquadrate cartilage morphology, abnormal AB + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b standard conditions Fig. 1 with image from Talbot et al., 2010
palatoquadrate cartilage morphology, abnormal Df(Chr01:hand2)s6/s6 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal Df(Chr01:hand2)s6/s6 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
Meckel's cartilage decreased length, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
Meckel's cartilage morphology, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
pharyngeal arch 2 skeleton joint absent, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
mandibular arch skeleton joint absent, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
Meckel's cartilage tapered, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
Citations