Morpholino
MO1-neurog1
- ID
- ZDB-MRPHLNO-050202-1
- Name
- MO1-neurog1
- Previous Names
- Target
- Sequence
-
5' - ACGATCTCCATTGTTGATAACCTGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-neurog1
Expressed Gene | Anatomy | Figures |
---|---|---|
atoh1a |
Fig. 3
from Sapède et al., 2012 |
|
camkvb |
|
Fig. 4 ![]() |
gsc |
Fig. 1 ![]() |
|
neurod1 |
|
Fig. 6
from Sapède et al., 2012 |
neurod4 |
|
Fig. 6
from Sapède et al., 2012 |
1 - 5 of 8 Show all
Phenotype
Phenotype resulting from MO1-neurog1
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-neurog1
1 - 5 of 7 Show all
Citations
- Rosa, J.B., Nassman, K.Y., Sagasti, A. (2022) Sensory axons induce epithelial lipid microdomain remodeling and determine the distribution of junctions in the epidermis. Molecular biology of the cell. 34(1):ar5
- Iwasaki, M., Yokoi, H., Suzuki, T., Kawakami, K., Wada, H. (2020) Development of the anterior lateral line system through local tissue-tissue interactions in the zebrafish head. Developmental Dynamics : an official publication of the American Association of Anatomists. 249(12):1440-1454
- Jiang, N., Rasmussen, J.P., Clanton, J.A., Rosenberg, M.F., Luedke, K.P., Cronan, M.R., Parker, E.D., Kim, H.J., Vaughan, J.C., Sagasti, A., Parrish, J.Z. (2019) A conserved morphogenetic mechanism for epidermal ensheathment of nociceptive sensory neurites. eLIFE. 8:
- Dyballa, S., Savy, T., Germann, P., Mikula, K., Remesikova, M., Špir, R., Zecca, A., Peyriéras, N., Pujades, C. (2017) Distribution of neurosensory progenitor pools during inner ear morphogenesis unveiled by cell lineage reconstruction. eLIFE. 6
- Kantarci, H., Gerberding, A., Riley, B.B. (2016) Spemann organizer gene Goosecoid promotes delamination of neuroblasts from the otic vesicle. Proceedings of the National Academy of Sciences of the United States of America. 113(44):E6840-E6848
- Pujol-Martí, J., Faucherre, A., Aziz-Bose, R., Asgharsharghi, A., Colombelli, J., Trapani, J.G., López-Schier, H. (2014) Converging Axons Collectively Initiate and Maintain Synaptic Selectivity in a Constantly Remodeling Sensory Organ. Current biology : CB. 24(24):2968-74
- O'Brien, G.S., Rieger, S., Wang, F., Smolen, G.A., Gonzalez, R.E., Buchanan, J., and Sagasti, A. (2012) Coordinate development of skin cells and cutaneous sensory axons in zebrafish. The Journal of comparative neurology. 520(4):816-31
- Sapède, D., Dyballa, S., and Pujades, C. (2012) Cell lineage analysis reveals three different progenitor pools for neurosensory elements in the otic vesicle. The Journal of neuroscience : the official journal of the Society for Neuroscience. 32(46):16424-16434
- Cox, J.A., Lamora, A., Johnson, S.L., and Voigt, M.M. (2011) Diverse mechanisms for assembly of branchiomeric nerves. Developmental Biology. 357(2):305-17
- Rieger, S., and Sagasti, A. (2011) Hydrogen peroxide promotes injury-induced peripheral sensory axon regeneration in the zebrafish skin. PLoS Biology. 9(5):e1000621
1 - 10 of 17
Show