Morpholino
MO1-trpa1b
- ID
- ZDB-MRPHLNO-050106-4
- Name
- MO1-trpa1b
- Previous Names
- Target
- Sequence
-
5' - TCACTAACTCCTTTCCAAACTGCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
A trpa1l translation blocking morpholino
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-trpa1b
No data available
Phenotype
Phenotype resulting from MO1-trpa1b
| Phenotype | Fish | Figures |
|---|---|---|
| chemosensory behavior decreased occurrence, abnormal | WT + MO1-trpa1b |
Fig. 2
from Faucherre et al., 2013 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-trpa1b
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| chemosensory behavior decreased occurrence, abnormal | WT + MO1-trpa1b | standard conditions |
Fig. 2
from Faucherre et al., 2013 |
1 - 1 of 1
Citations
- Faucherre, A., Nargeot, J., Mangoni, M.E., and Jopling, C. (2013) piezo2b Regulates Vertebrate Light Touch Response. The Journal of neuroscience : the official journal of the Society for Neuroscience. 33(43):17089-17094
- Corey, D.P., García-Añoveros, J., Holt, J.R., Kwan, K.Y., Lin, S.Y., Vollrath, M.A., Amalfitano, A., Cheung, E.L., Derfler, B.H., Duggan, A., Géléoc, G.S., Gray, P.A., Hoffman, M.P., Rehm, H.L., Tamasauskas, D., Zhang, D.S. (2004) TRPA1 is a candidate for the mechanosensitive transduction channel of vertebrate hair cells. Nature. 432(7018):723-730
1 - 2 of 2
Show