Morpholino

MO1-notch1a

ID
ZDB-MRPHLNO-041207-4
Name
MO1-notch1a
Previous Names
  • MO-notch1a-1 (1)
Target
Sequence
5' - GAAACGGTTCATAACTCCGCCTCGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
designed to bind to 5'-end of gene
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-notch1a
No data available
Phenotype
Phenotype resulting from MO1-notch1a
Phenotype Fish Figures
choroid plexus fourth ventricle shape, abnormal mn16Et + MO1-notch1a Fig. 5 with image from Bill et al., 2008
Phenotype of all Fish created by or utilizing MO1-notch1a
Phenotype Fish Conditions Figures
choroid plexus fourth ventricle shape, abnormal mn16Et + MO1-notch1a standard conditions Fig. 5 with image from Bill et al., 2008
whole organism runx1 expression amount, ameliorated TU + MO1-mettl3 + MO1-notch1a standard conditions Fig. 3 from Zhang et al., 2017
retinal cone cell amount, ameliorated WT + MO1-id2a + MO1-notch1a control Fig. 5 with image from Uribe et al., 2012
retina cell population proliferation process quality, ameliorated WT + MO1-id2a + MO1-notch1a standard conditions Fig. 4 with image from Uribe et al., 2012
eye cell amount, ameliorated WT + MO1-id2a + MO1-notch1a standard conditions Fig. 4 with image from Uribe et al., 2012
amacrine cell amount, ameliorated WT + MO1-id2a + MO1-notch1a control Fig. 5 with image from Uribe et al., 2012
camera-type eye photoreceptor cell differentiation process quality, ameliorated WT + MO1-id2a + MO1-notch1a control Fig. 5 with image from Uribe et al., 2012
neural plate morphology, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 1 from Yeo et al., 2007
negative regulation of neurogenesis decreased occurrence, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
Notch signaling pathway decreased occurrence, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
central nervous system cellular quality, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Yeo et al., 2007
neurogenesis increased occurrence, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
neural plate development process quality, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 1 from Yeo et al., 2007
negative regulation of neurogenesis decreased occurrence, abnormal WT + MO1-nlk1 + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
Notch signaling pathway decreased occurrence, abnormal WT + MO1-nlk1 + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
neurogenesis increased occurrence, abnormal WT + MO1-nlk1 + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
peripheral neuron decreased length, abnormal knu2Tg + MO1-notch1a + MO1-notch3 + MO4-notch1b standard conditions Fig. 4 from So et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.