miRNA Gene
dre-let-7b
- ID
- ZDB-MIRNAG-081203-3
- Name
- microRNA let7b
- Symbol
- dre-let-7b Nomenclature History
- Previous Names
- Type
- miRNA_gene
- Location
- Chr: 4 Mapping Details/Browsers
- Description
- Involved in regulation of gene silencing by miRNA.
- Genome Resources
- Note
-
UGAGGUAGUAGGUUGUGUGGUU
- Comparative Information
-
- All Expression Data
- 3 figures from 3 publications
- Cross-Species Comparison
- High Throughput Data
- Thisse Expression Data
- No data available
Wild Type Expression Summary
- All Phenotype Data
- No data available
- Cross-Species Comparison
- Alliance
Phenotype Summary
Mutations
Human Disease
Domain, Family, and Site Summary
No data available
Domain Details Per Protein
No data available
- Genome Browsers
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| miRNA | mirlet7b-001 (1) | 22 nt |
Interactions and Pathways
No data available
Plasmids
No data available