IMAGE

Fig. S6

ID
ZDB-IMAGE-101021-31
Source
Figures for Kwon et al., 2010
Image
Figure Caption

Fig. S6 Effects of p63-MO and gata3-MO2 on accumulation of mature mRNA. (A) p63-MO leads to an aberrantly spliced transcript. Control embryos or embryos injected with p63 splice blocker were lysed at 11 hpf to collect mRNA. Primers for p63 and a constitutive control, ornithine decarboxylase (odc) were added to lysates to synthesize cDNA, which was then amplified for 30 cycles. p63-MO caused loss of wild-type transcript and accumulation of an aberrant splice product of higher molecular weight. (B) gata3-MO2 causes loss of gata3 transcript. Control embryos or embryos injected with gata3-MO2 (splice-blocker) were lysed at 12 hpf to collect mRNA. Primers for gata3 and odc were added to lysates to synthesize cDNA, which was then amplified for 30 cycles. Primers for gata3 flanked the splice junction between exons 1 and 2. Primer sequences: gata3: GTGTTGTGTGTATCGGTGAGTG, GAGGAGGAAGAAGCTGGAGG; odc: GGATGTCCTGAAGCACCT, CCCACTGACTGCACGAT; p63: Primers were the same as those used previously [63].

Acknowledgments
This image is the copyrighted work of the attributed author or publisher, and ZFIN has permission only to display this image to its users. Additional permissions should be obtained from the applicable author or publisher of the image. Full text @ PLoS Genet.