CRISPR

CRISPR5-foxg1a

ID
ZDB-CRISPR-241204-2
Name
CRISPR5-foxg1a
Previous Names
None
Target
Sequence
5' - GTTGTCGCTTTGCACGGCTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sud24 foxg1a
Expression
Gene expression in Wild Types + CRISPR5-foxg1a
No data available
Phenotype
Phenotype resulting from CRISPR5-foxg1a
No data available
Phenotype of all Fish created by or utilizing CRISPR5-foxg1a
Phenotype Fish Conditions Figures
preoptic area malformed, abnormal foxg1asud24/sud24 standard conditions Fig. 5 with imageFig. 6 with image from Umeda et al., 2024
telencephalon hypotrophic, abnormal foxg1asud24/sud24 standard conditions Fig. 6 with image from Umeda et al., 2024
telencephalon ventricular zone ascl1a expression decreased amount, abnormal foxg1asud24/sud24 standard conditions Fig. 11 with image from Umeda et al., 2024
dorsal telencephalon increased size, abnormal foxg1asud24/sud24 standard conditions Fig. 9 with image from Umeda et al., 2024
ventral telencephalon dlx2a expression absent, abnormal foxg1asud24/sud24 standard conditions Fig. 7 with image from Umeda et al., 2024
liver cell death increased occurrence, abnormal foxg1asud24/sud24 standard conditions Fig. 5 with image from Umeda et al., 2024
telencephalon fgf8a expression increased distribution, abnormal foxg1asud24/sud24 standard conditions Fig. 9 with image from Umeda et al., 2024
embryonic viscerocranium morphogenesis decreased process quality, abnormal foxg1asud24/sud24 standard conditions Fig. 5 with image from Umeda et al., 2024
preoptic area shha expression decreased amount, abnormal foxg1asud24/sud24 standard conditions Fig. 11 with image from Umeda et al., 2024
dorsal telencephalon emx3 expression increased distribution, abnormal foxg1asud24/sud24 standard conditions Fig. 7 with image from Umeda et al., 2024
telencephalon ventricular zone nr2f1a expression decreased amount, abnormal foxg1asud24/sud24 standard conditions Fig. 11 with image from Umeda et al., 2024
ventral telencephalon emx3 expression mislocalised, abnormal foxg1asud24/sud24 standard conditions Fig. 7 with image from Umeda et al., 2024
preoptic area cell death increased occurrence, abnormal foxg1asud24/sud24 standard conditions Fig. 5 with image from Umeda et al., 2024
telencephalon development decreased process quality, abnormal foxg1asud24/sud24 standard conditions Fig. 5 with image from Umeda et al., 2024
hypothalamus nkx2.4b expression decreased amount, abnormal foxg1asud24/sud24 standard conditions Fig. 7 with image from Umeda et al., 2024
dorsal telencephalon tbr1b expression increased distribution, abnormal foxg1asud24/sud24 standard conditions Fig. 7 with image from Umeda et al., 2024
dorsal telencephalon neurog1 expression increased distribution, abnormal foxg1asud24/sud24 standard conditions Fig. 7 with image from Umeda et al., 2024
preoptic area nkx2.1 expression absent, abnormal foxg1asud24/sud24 standard conditions Fig. 7 with image from Umeda et al., 2024
telencephalon vax2 expression increased distribution, abnormal foxg1asud24/sud24 standard conditions Fig. 9 with image from Umeda et al., 2024
dorsal telencephalon neurod1 expression decreased distribution, abnormal foxg1asud24/sud24 standard conditions Fig. 7 with image from Umeda et al., 2024
telencephalon ventricular zone pax6a expression decreased amount, abnormal foxg1asud24/sud24 standard conditions Fig. 11 with image from Umeda et al., 2024
dorsal telencephalon emx1 expression decreased amount, abnormal foxg1asud24/sud24 standard conditions Fig. 7 with image from Umeda et al., 2024
pallium development decreased process quality, abnormal foxg1asud24/sud24 standard conditions Fig. 7 with imageFig. 9 with image from Umeda et al., 2024
telencephalon six3b expression increased distribution, abnormal foxg1asud24/sud24 standard conditions Fig. 9 with image from Umeda et al., 2024
ventral telencephalon gad1b expression absent, abnormal foxg1asud24/sud24 standard conditions Fig. 7 with image from Umeda et al., 2024
preoptic area decreased size, abnormal foxg1asud24/sud24 standard conditions Fig. 9 with image from Umeda et al., 2024
olfactory placode neurod1 expression decreased amount, abnormal foxg1asud24/sud24 standard conditions Fig. 7 with image from Umeda et al., 2024
mandibular arch skeleton hypoplastic, abnormal foxg1asud24/sud24 standard conditions Fig. 5 with image from Umeda et al., 2024
dorsal telencephalon tbr1b expression increased amount, abnormal foxg1asud24/sud24 standard conditions Fig. 7 with image from Umeda et al., 2024
telencephalon emx3 expression increased distribution, abnormal foxg1asud24/sud24 standard conditions Fig. 8 with image from Umeda et al., 2024
dorsal telencephalon neurod1 expression decreased amount, abnormal foxg1asud24/sud24 standard conditions Fig. 7 with image from Umeda et al., 2024
telencephalon decreased thickness, abnormal foxg1asud24/sud24 standard conditions Fig. 5 with image from Umeda et al., 2024
subpallium development decreased process quality, abnormal foxg1asud24/sud24 standard conditions Fig. 7 with imageFig. 9 with image from Umeda et al., 2024
telencephalon fgf8a expression increased distribution, abnormal foxg1asud24/+ standard conditions Fig. 9 with image from Umeda et al., 2024
telencephalon vax2 expression increased distribution, abnormal foxg1asud24/+ standard conditions Fig. 9 with image from Umeda et al., 2024
telencephalon six3b expression increased distribution, abnormal foxg1asud24/+ standard conditions Fig. 9 with image from Umeda et al., 2024
Citations