CRISPR

CRISPR1-scfd1

ID
ZDB-CRISPR-240909-3
Name
CRISPR1-scfd1
Previous Names
None
Target
Sequence
5' - TGTTCTTGCGGATCGTAACCTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
vcc44 scfd1
Expression
Gene expression in Wild Types + CRISPR1-scfd1
No data available
Phenotype
Phenotype resulting from CRISPR1-scfd1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-scfd1
Phenotype Fish Conditions Figures
ventricular myocardium Z disc decreased amount, abnormal scfd1vcc44/vcc44 standard conditions Figure 4 with image from Huttner et al., 2023
whole organism xbp1 expression increased amount, abnormal scfd1vcc44/vcc44 standard conditions Figure 5 with image from Huttner et al., 2023
ventricular myocardium Z disc decreased width, abnormal scfd1vcc44/vcc44 standard conditions Figure 4 with image from Huttner et al., 2023
ventricular myocardium cardiac muscle cell decreased thickness, abnormal scfd1vcc44/vcc44 standard conditions Figure 4 with image from Huttner et al., 2023
whole organism casp9 expression increased amount, abnormal scfd1vcc44/vcc44 standard conditions Figure 5 with image from Huttner et al., 2023
whole organism eif2s1a expression increased amount, abnormal scfd1vcc44/vcc44 standard conditions Figure 5 with image from Huttner et al., 2023
pericardium edematous, abnormal scfd1vcc44/vcc44 standard conditions Figure 2 with image from Huttner et al., 2023
cardiac muscle cell Golgi-associated vesicle increased amount, abnormal scfd1vcc44/vcc44 standard conditions Figure 5 with image from Huttner et al., 2023
eye decreased size, abnormal scfd1vcc44/vcc44 standard conditions Figure 2 with image from Huttner et al., 2023
whole organism hspa5 expression increased amount, abnormal scfd1vcc44/vcc44 standard conditions Figure 5 with image from Huttner et al., 2023
ventricular myocardium cardiac muscle cell elongated, abnormal scfd1vcc44/vcc44 standard conditions Figure 4 with image from Huttner et al., 2023
whole organism atf6 expression increased amount, abnormal scfd1vcc44/vcc44 standard conditions Figure 5 with image from Huttner et al., 2023
whole organism atf4a expression increased amount, abnormal scfd1vcc44/vcc44 standard conditions Figure 5 with image from Huttner et al., 2023
whole organism Ab1-scfd1 labeling absent, abnormal scfd1vcc44/vcc44 standard conditions Figure 2 with image from Huttner et al., 2023
whole organism ddit3 expression increased amount, abnormal scfd1vcc44/vcc44 standard conditions Figure 5 with image from Huttner et al., 2023
whole organism dead, abnormal scfd1vcc44/vcc44 standard conditions Figure 3 with image from Huttner et al., 2023
heart morphology, abnormal scfd1vcc44/vcc44 standard conditions Figure 2 with image from Huttner et al., 2023
whole organism scfd1 expression decreased amount, abnormal scfd1vcc44/vcc44 standard conditions Figure 2 with image from Huttner et al., 2023
cardiac muscle cell endoplasmic reticulum morphology, abnormal scfd1vcc44/vcc44 standard conditions Figure 5 with image from Huttner et al., 2023
ventricular myocardium sarcomere disorganized, abnormal scfd1vcc44/vcc44 standard conditions Figure 4 with image from Huttner et al., 2023
ventral mandibular arch absence of anatomical entity, abnormal scfd1vcc44/vcc44 standard conditions Figure 2 with image from Huttner et al., 2023
cardiac muscle cell Golgi apparatus increased size, abnormal scfd1vcc44/vcc44 standard conditions Figure 5 with image from Huttner et al., 2023
heart contraction decreased process quality, abnormal scfd1vcc44/vcc44 standard conditions Figure 3 with image from Huttner et al., 2023
ventricular myocardium cardiac muscle cell decreased length, abnormal scfd1vcc44/vcc44 standard conditions Figure 4 with image from Huttner et al., 2023
whole organism viability, abnormal scfd1vcc44/vcc44 standard conditions Figure 3 with image from Huttner et al., 2023
whole organism ern2 expression increased amount, abnormal scfd1vcc44/vcc44 standard conditions Figure 5 with image from Huttner et al., 2023
heart contraction decreased rate of continuous process, abnormal scfd1vcc44/vcc44 standard conditions Figure 3 with image from Huttner et al., 2023
whole organism eif2ak3 expression increased amount, abnormal scfd1vcc44/vcc44 standard conditions Figure 5 with image from Huttner et al., 2023
ventricular myocardium sarcomere decreased amount, abnormal scfd1vcc44/vcc44 standard conditions Figure 4 with image from Huttner et al., 2023
whole organism regulation of response to endoplasmic reticulum stress increased process quality, abnormal scfd1vcc44/vcc44 standard conditions Figure 5 with image from Huttner et al., 2023
heart contraction process quality, abnormal scfd1vcc44/+ standard conditions Figure 6 with image from Huttner et al., 2023
whole organism Ab1-scfd1 labeling decreased amount, abnormal scfd1vcc44/+ standard conditions Figure 2 with image from Huttner et al., 2023
Citations