CRISPR

CRISPR1-trappc9

ID
ZDB-CRISPR-240729-2
Name
CRISPR1-trappc9
Previous Names
None
Target
Sequence
5' - GGCCATGTGATAATGAACGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
scu303 trappc9
scu304 trappc9
scu305 trappc9
scu306 trappc9
scu307 trappc9
Expression
Gene expression in Wild Types + CRISPR1-trappc9
No data available
Phenotype
Phenotype resulting from CRISPR1-trappc9
No data available
Phenotype of all Fish created by or utilizing CRISPR1-trappc9
Phenotype Fish Conditions Figures
whole organism neflb expression decreased amount, abnormal trappc9scu303/scu303 (AB) standard conditions Figure 2 with image from Hu et al., 2023
intertectal commissure axon decreased amount, abnormal trappc9scu303/scu303 (AB) standard conditions Figure 2 with image from Hu et al., 2023
intertectal commissure axon decreased length, abnormal trappc9scu303/scu303 (AB) standard conditions Figure 2 with image from Hu et al., 2023
hindbrain neflb expression decreased distribution, abnormal trappc9scu303/scu303 (AB) standard conditions Figure 2 with image from Hu et al., 2023
midbrain neflb expression decreased distribution, abnormal trappc9scu303/scu303 (AB) standard conditions Figure 2 with image from Hu et al., 2023
brain myelination decreased process quality, abnormal trappc9scu303/scu303 (AB) standard conditions Figure 3 with image from Hu et al., 2023
intertectal commissure axon ab1-tuba labeling decreased distribution, abnormal trappc9scu303/scu303 (AB) standard conditions Figure 2 with image from Hu et al., 2023
brain decreased size, abnormal trappc9scu303/scu303 (AB) standard conditions Fig. S2 from Hu et al., 2023
brain mbpb expression decreased distribution, abnormal trappc9scu303/scu303 (AB) standard conditions Figure 3 with image from Hu et al., 2023
brain map2 expression decreased distribution, abnormal trappc9scu303/scu303 (AB) standard conditions Figure 4 with image from Hu et al., 2023
whole organism mbpb expression decreased amount, abnormal trappc9scu303/scu303 (AB) control Figure 3 with image from Hu et al., 2023
whole organism map2 expression decreased amount, abnormal trappc9scu303/scu303 (AB) standard conditions Figure 4 with image from Hu et al., 2023
intertectal commissure axon decreased amount, abnormal trappc9scu304/scu304 (AB) standard conditions Figure 2 with image from Hu et al., 2023
intertectal commissure axon decreased length, abnormal trappc9scu304/scu304 (AB) standard conditions Figure 2 with image from Hu et al., 2023
brain myelination decreased process quality, abnormal trappc9scu304/scu304 (AB) standard conditions Figure 3 with image from Hu et al., 2023
midbrain neflb expression decreased distribution, abnormal trappc9scu304/scu304 (AB) standard conditions Figure 2 with image from Hu et al., 2023
hindbrain neflb expression decreased distribution, abnormal trappc9scu304/scu304 (AB) standard conditions Figure 2 with image from Hu et al., 2023
intertectal commissure axon ab1-tuba labeling decreased distribution, abnormal trappc9scu304/scu304 (AB) standard conditions Figure 2 with image from Hu et al., 2023
whole organism neflb expression decreased amount, abnormal trappc9scu304/scu304 (AB) standard conditions Figure 2 with image from Hu et al., 2023
brain decreased size, abnormal trappc9scu304/scu304 (AB) standard conditions Fig. S2 from Hu et al., 2023
brain mbpb expression decreased distribution, abnormal trappc9scu304/scu304 (AB) standard conditions Figure 3 with image from Hu et al., 2023
whole organism mbpb expression decreased amount, abnormal trappc9scu304/scu304 (AB) control Figure 3 with image from Hu et al., 2023
brain map2 expression decreased distribution, abnormal trappc9scu304/scu304 (AB) standard conditions Figure 4 with image from Hu et al., 2023
whole organism map2 expression decreased amount, abnormal trappc9scu304/scu304 (AB) standard conditions Figure 4 with image from Hu et al., 2023
intertectal commissure axon decreased amount, abnormal trappc9scu305/scu305 (AB) standard conditions Figure 2 with image from Hu et al., 2023
midbrain neflb expression decreased distribution, abnormal trappc9scu305/scu305 (AB) standard conditions Figure 2 with image from Hu et al., 2023
brain myelination decreased process quality, abnormal trappc9scu305/scu305 (AB) standard conditions Figure 3 with image from Hu et al., 2023
hindbrain neflb expression decreased distribution, abnormal trappc9scu305/scu305 (AB) standard conditions Figure 2 with image from Hu et al., 2023
intertectal commissure axon ab1-tuba labeling decreased distribution, abnormal trappc9scu305/scu305 (AB) standard conditions Figure 2 with image from Hu et al., 2023
whole organism neflb expression decreased amount, abnormal trappc9scu305/scu305 (AB) standard conditions Figure 2 with image from Hu et al., 2023
intertectal commissure axon decreased length, abnormal trappc9scu305/scu305 (AB) standard conditions Figure 2 with image from Hu et al., 2023
brain decreased size, abnormal trappc9scu305/scu305 (AB) standard conditions Fig. S2 from Hu et al., 2023
whole organism mbpb expression decreased amount, abnormal trappc9scu305/scu305 (AB) control Figure 3 with image from Hu et al., 2023
brain mbpb expression decreased distribution, abnormal trappc9scu305/scu305 (AB) standard conditions Figure 3 with image from Hu et al., 2023
whole organism map2 expression decreased amount, abnormal trappc9scu305/scu305 (AB) standard conditions Figure 4 with image from Hu et al., 2023
brain map2 expression decreased distribution, abnormal trappc9scu305/scu305 (AB) standard conditions Figure 4 with image from Hu et al., 2023
intertectal commissure axon decreased amount, abnormal trappc9scu306/scu306 (AB) standard conditions Figure 2 with image from Hu et al., 2023
midbrain neflb expression decreased distribution, abnormal trappc9scu306/scu306 (AB) standard conditions Figure 2 with image from Hu et al., 2023
brain myelination decreased process quality, abnormal trappc9scu306/scu306 (AB) standard conditions Figure 3 with image from Hu et al., 2023
hindbrain neflb expression decreased distribution, abnormal trappc9scu306/scu306 (AB) standard conditions Figure 2 with image from Hu et al., 2023
intertectal commissure axon ab1-tuba labeling decreased distribution, abnormal trappc9scu306/scu306 (AB) standard conditions Figure 2 with image from Hu et al., 2023
whole organism neflb expression decreased amount, abnormal trappc9scu306/scu306 (AB) standard conditions Figure 2 with image from Hu et al., 2023
intertectal commissure axon decreased length, abnormal trappc9scu306/scu306 (AB) standard conditions Figure 2 with image from Hu et al., 2023
brain decreased size, abnormal trappc9scu306/scu306 (AB) standard conditions Fig. S2 from Hu et al., 2023
whole organism mbpb expression decreased amount, abnormal trappc9scu306/scu306 (AB) control Figure 3 with image from Hu et al., 2023
brain mbpb expression decreased distribution, abnormal trappc9scu306/scu306 (AB) standard conditions Figure 3 with image from Hu et al., 2023
brain map2 expression decreased distribution, abnormal trappc9scu306/scu306 (AB) standard conditions Figure 4 with image from Hu et al., 2023
whole organism map2 expression decreased amount, abnormal trappc9scu306/scu306 (AB) standard conditions Figure 4 with image from Hu et al., 2023
midbrain neflb expression decreased distribution, abnormal trappc9scu307/scu307 (AB) standard conditions Figure 2 with image from Hu et al., 2023
intertectal commissure axon decreased amount, abnormal trappc9scu307/scu307 (AB) standard conditions Figure 2 with image from Hu et al., 2023
brain myelination decreased process quality, abnormal trappc9scu307/scu307 (AB) standard conditions Figure 3 with image from Hu et al., 2023
hindbrain neflb expression decreased distribution, abnormal trappc9scu307/scu307 (AB) standard conditions Figure 2 with image from Hu et al., 2023
intertectal commissure axon ab1-tuba labeling decreased distribution, abnormal trappc9scu307/scu307 (AB) standard conditions Figure 2 with image from Hu et al., 2023
whole organism neflb expression decreased amount, abnormal trappc9scu307/scu307 (AB) standard conditions Figure 2 with image from Hu et al., 2023
intertectal commissure axon decreased length, abnormal trappc9scu307/scu307 (AB) standard conditions Figure 2 with image from Hu et al., 2023
brain decreased size, abnormal trappc9scu307/scu307 (AB) standard conditions Fig. S2 from Hu et al., 2023
whole organism mbpb expression decreased amount, abnormal trappc9scu307/scu307 (AB) control Figure 3 with image from Hu et al., 2023
brain mbpb expression decreased distribution, abnormal trappc9scu307/scu307 (AB) standard conditions Figure 3 with image from Hu et al., 2023
brain map2 expression decreased distribution, abnormal trappc9scu307/scu307 (AB) standard conditions Figure 4 with image from Hu et al., 2023
whole organism map2 expression decreased amount, abnormal trappc9scu307/scu307 (AB) standard conditions Figure 4 with image from Hu et al., 2023
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.