CRISPR

CRISPR1-tlcd3bb

ID

ZDB-CRISPR-240530-3

Name

CRISPR1-tlcd3bb

Previous Names

None

Target

tlcd3bb (1)

Sequence

5' - GATGATGTCCTGGCAGGAAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "AGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3799	tlcd3bb

Expression

Gene expression in Wild Types + CRISPR1-tlcd3bb

No data available

Phenotype

Phenotype resulting from CRISPR1-tlcd3bb

No data available

Phenotype of all Fish created by or utilizing CRISPR1-tlcd3bb

Phenotype	Fish	Conditions	Figures
brain phosphatidylethanolamine (16:0/22:6) decreased amount, abnormal	tlcd3bb^zf3799/+; tlcd3ba^zf3800/+ (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain phosphatidylethanolamine 16:0_20:3 decreased amount, abnormal	tlcd3bb^zf3799/+; tlcd3ba^zf3800/+ (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain phosphatidylethanolamine (18:0/22:6) decreased amount, abnormal	tlcd3bb^zf3799/+; tlcd3ba^zf3800/+ (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain lysophosphatidylcholine decreased amount, abnormal	tlcd3bb^zf3799/+; tlcd3ba^zf3800/+ (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain phosphatidylethanolamine (18:0/20:3) decreased amount, abnormal	tlcd3bb^zf3799/+; tlcd3ba^zf3800/+ (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain coenzyme decreased amount, abnormal	tlcd3bb^zf3799/+; tlcd3ba^zf3800/+ (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain phosphatidylinositol increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain ceramide increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain HexCer(d18:1/16:0) increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain phosphatidylethanolamine increased distribution, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 7 from Tomasello et al., 2021
brain Ab4-syt1 labeling spatial pattern, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 7 from Tomasello et al., 2021
brain ganglioside GM1 increased distribution, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 7 from Tomasello et al., 2021
brain Ab4-syt1 labeling increased distribution, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 7 from Tomasello et al., 2021
swimming behavior increased process quality, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	chemical treatment by environment: pentetrazol	Fig. 8 from Tomasello et al., 2021
brain membrane raft increased distribution, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 7 from Tomasello et al., 2021
brain monoacylglycerol increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
startle response decreased process quality, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	altered light dark cycle	Fig. 8 from Tomasello et al., 2021
brain PE(18:1_20:4) increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain sphingomyelin increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain lysophosphatidylethanolamine increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain PE(18:1_20:3) increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain action potential propagation decreased process quality, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	control	Fig. 8 from Tomasello et al., 2021
brain monoacylglycerol 18:0 increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain cardiolipin increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain action potential decreased process quality, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	control	Fig. 8 from Tomasello et al., 2021

Citations