CRISPR

CRISPR1-capza1b

ID
ZDB-CRISPR-231025-4
Name
CRISPR1-capza1b
Previous Names
None
Target
Sequence
5' - AGCGATCCTCAACCGTATGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
pc56 capza1b
Expression
Gene expression in Wild Types + CRISPR1-capza1b
No data available
Phenotype
Phenotype resulting from CRISPR1-capza1b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-capza1b
Phenotype Fish Conditions Figures
myotome sarcomere ab1-actn labeling spatial pattern, abnormal capza1bpc56/pc56 (TU) standard conditions Fig 5 with image from Berger et al., 2022
myotome sarcomere ab1-actn labeling mislocalised, abnormal capza1bpc56/pc56 (TU) standard conditions Fig 5 with image from Berger et al., 2022
trunk musculature skeletal muscle contraction decreased magnitude, abnormal capza1bpc56/pc56 (TU) standard conditions Fig 5 with image from Berger et al., 2022
trunk capza1b expression decreased amount, abnormal capza1bpc56/pc56 (TU) standard conditions Fig 4 with image from Berger et al., 2022
myotome sarcomere organization decreased process quality, abnormal capza1bpc56/pc56 (TU) standard conditions Fig 5 with image from Berger et al., 2022
myotome myofibril assembly decreased process quality, abnormal capza1bpc56/pc56 (TU) standard conditions Fig 4 with image,  Fig 7 with image from Berger et al., 2022
myotome skeletal muscle myofibril decreased amount, abnormal capza1bpc56/pc56 (TU) standard conditions Fig 4 with image from Berger et al., 2022
myotome skeletal muscle myofibril disorganized, abnormal capza1bpc56/+; pc21Tg; pc22Tg standard conditions Fig 5 with image from Berger et al., 2022
myotome myofibril assembly decreased process quality, abnormal capza1bpc56/+; pc21Tg; pc22Tg standard conditions Fig 5 with image from Berger et al., 2022
myotome skeletal muscle myofibril disorganized, abnormal capza1bpc56/pc56; pc21Tg; pc22Tg standard conditions Fig 5 with image from Berger et al., 2022
myotome sarcomere EGFP expression spatial pattern, abnormal capza1bpc56/pc56; pc21Tg; pc22Tg standard conditions Fig 6 with image,  Fig 7 with image from Berger et al., 2022
myotome striated muscle thin filament mislocalised, abnormal capza1bpc56/pc56; pc21Tg; pc22Tg standard conditions Fig 6 with image from Berger et al., 2022
myotome myofibril assembly decreased process quality, abnormal capza1bpc56/pc56; pc21Tg; pc22Tg standard conditions Fig 5 with image,  Fig 7 with image from Berger et al., 2022
myotome sarcomere EGFP expression mislocalised, abnormal capza1bpc56/pc56; pc21Tg; pc22Tg standard conditions Fig 6 with image,  Fig 7 with image from Berger et al., 2022
myotome peripheral region has extra parts of type myotome protein-containing complex, abnormal capza1bpc56/pc56; pc21Tg; pc22Tg standard conditions Fig 6 with image,  Fig 7 with image from Berger et al., 2022
myotome skeletal muscle myofibril decreased amount, abnormal capza1apc55/+; capza1bpc56/+ (TU) standard conditions Fig 4 with image from Berger et al., 2022
myotome myofibril assembly decreased process quality, abnormal capza1apc55/+; capza1bpc56/+ (TU) standard conditions Fig 4 with image from Berger et al., 2022
myotome myofibril assembly decreased process quality, abnormal capza1apc55/+; capza1bpc56/pc56 (TU) standard conditions Fig 4 with image from Berger et al., 2022
myotome skeletal muscle myofibril decreased amount, abnormal capza1apc55/+; capza1bpc56/pc56 (TU) standard conditions Fig 4 with image from Berger et al., 2022
myotome sarcomere EGFP expression spatial pattern, abnormal capza1apc55/+; capza1bpc56/pc56; pc21Tg; pc22Tg standard conditions Fig 6 with image from Berger et al., 2022
myotome striated muscle thin filament mislocalised, abnormal capza1apc55/+; capza1bpc56/pc56; pc21Tg; pc22Tg standard conditions Fig 6 with image from Berger et al., 2022
myotome sarcomere EGFP expression mislocalised, abnormal capza1apc55/+; capza1bpc56/pc56; pc21Tg; pc22Tg standard conditions Fig 6 with image from Berger et al., 2022
myotome peripheral region has extra parts of type myotome protein-containing complex, abnormal capza1apc55/+; capza1bpc56/pc56; pc21Tg; pc22Tg standard conditions Fig 6 with image from Berger et al., 2022
myotome skeletal muscle myofibril decreased amount, abnormal capza1apc55/pc55; capza1bpc56/+ (TU) standard conditions Fig 4 with image from Berger et al., 2022
myotome myofibril assembly decreased process quality, abnormal capza1apc55/pc55; capza1bpc56/+ (TU) standard conditions Fig 4 with image from Berger et al., 2022
myotome peripheral region has extra parts of type myotome protein-containing complex, abnormal capza1apc55/pc55; capza1bpc56/pc56 (TU) standard conditions Fig 6 with image from Berger et al., 2022
whole organism dead, abnormal capza1apc55/pc55; capza1bpc56/pc56 (TU) standard conditions Fig 4 with image from Berger et al., 2022
myotome striated muscle thin filament mislocalised, abnormal capza1apc55/pc55; capza1bpc56/pc56 (TU) standard conditions Fig 6 with image from Berger et al., 2022
myotome sarcomere EGFP expression spatial pattern, abnormal capza1apc55/pc55; capza1bpc56/pc56; pc21Tg; pc22Tg standard conditions Fig 6 with image from Berger et al., 2022
myotome sarcomere EGFP expression mislocalised, abnormal capza1apc55/pc55; capza1bpc56/pc56; pc21Tg; pc22Tg standard conditions Fig 6 with image from Berger et al., 2022
myotome striated muscle thin filament mislocalised, abnormal capza1apc55/pc55; capza1bpc56/pc56; pc21Tg; pc22Tg standard conditions Fig 6 with image from Berger et al., 2022
myotome peripheral region has extra parts of type myotome protein-containing complex, abnormal capza1apc55/pc55; capza1bpc56/pc56; pc21Tg; pc22Tg standard conditions Fig 6 with image from Berger et al., 2022
myotome myofibril assembly decreased process quality, abnormal lmod3sa13018/sa13018; capza1bpc56/pc56 (TU) standard conditions Fig 7 with image from Berger et al., 2022
myotome sarcomere EGFP expression spatial pattern, abnormal lmod3sa13018/sa13018; capza1bpc56/pc56; pc21Tg; pc22Tg standard conditions Fig 7 with image from Berger et al., 2022
myotome sarcomere EGFP expression mislocalised, abnormal lmod3sa13018/sa13018; capza1bpc56/pc56; pc21Tg; pc22Tg standard conditions Fig 7 with image from Berger et al., 2022
myotome myofibril assembly decreased process quality, abnormal lmod3sa13018/sa13018; capza1bpc56/pc56; pc21Tg; pc22Tg standard conditions Fig 7 with image from Berger et al., 2022
myotome peripheral region has extra parts of type myotome protein-containing complex, abnormal lmod3sa13018/sa13018; capza1bpc56/pc56; pc21Tg; pc22Tg standard conditions Fig 7 with image from Berger et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.