CRISPR

CRISPR1-gfi1ab

ID
ZDB-CRISPR-231006-17
Name
CRISPR1-gfi1ab
Previous Names
None
Target
Sequence
5' - GGTACTCGGGGTGTGAAATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
szy10 gfi1ab
Expression
Gene expression in Wild Types + CRISPR1-gfi1ab
No data available
Phenotype
Phenotype resulting from CRISPR1-gfi1ab
No data available
Phenotype of all Fish created by or utilizing CRISPR1-gfi1ab
Phenotype Fish Conditions Figures
endothelial cell clec14a expression increased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10 standard conditions FIGURE 2 with image from Wu et al., 2022
erythroid lineage cell sptb expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10 standard conditions FIGURE 1 with image from Wu et al., 2022
endothelial cell cdh5 expression increased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10 standard conditions FIGURE 2 with image from Wu et al., 2022
endothelial cell sox7 expression increased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10 standard conditions FIGURE 2 with image from Wu et al., 2022
erythroid lineage cell epb41b expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10 standard conditions FIGURE 1 with image from Wu et al., 2022
erythroid lineage cell hbae3 expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10 standard conditions FIGURE 1 with image from Wu et al., 2022
erythroid lineage cell hbbe3 expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10 standard conditions FIGURE 1 with image from Wu et al., 2022
erythroid lineage cell tfr1a expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10 standard conditions FIGURE 1 with image from Wu et al., 2022
endothelial cell flt4 expression increased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10 standard conditions FIGURE 2 with image from Wu et al., 2022
endothelial cell egfl7 expression increased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10 standard conditions FIGURE 2 with image from Wu et al., 2022
erythroid lineage cell alas2 expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10 standard conditions FIGURE 1 with image from Wu et al., 2022
erythroid lineage cell tfr1a expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 1 with image from Wu et al., 2022
erythroid lineage cell alas2 expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 1 with image from Wu et al., 2022
erythroid lineage cell hbbe3 expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 1 with image from Wu et al., 2022
erythroid lineage cell epb41b expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 1 with image from Wu et al., 2022
erythroid lineage cell hbae3 expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 1 with image from Wu et al., 2022
endothelial cell flt4 expression increased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 2 with image from Wu et al., 2022
erythroid lineage cell sptb expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 1 with image from Wu et al., 2022
endothelial cell clec14a expression increased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 2 with image from Wu et al., 2022
endothelial cell cdh5 expression increased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 2 with image from Wu et al., 2022
endothelial cell egfl7 expression increased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 2 with image from Wu et al., 2022
endothelial cell sox7 expression increased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 2 with image from Wu et al., 2022
Citations