CRISPR

CRISPR3-alx4a

ID
ZDB-CRISPR-230920-6
Name
CRISPR3-alx4a
Previous Names
None
Target
Sequence
5' - GGAGTATGAAACGCACGTCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two "G"s were added.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Expression
Gene expression in Wild Types + CRISPR3-alx4a
No data available
Phenotype
Phenotype resulting from CRISPR3-alx4a
No data available
Phenotype of all Fish created by or utilizing CRISPR3-alx4a
Phenotype Fish Conditions Figures
iridophore decreased amount, abnormal alx4aj320/j320 standard conditions Fig. 4 with image from Jang et al., 2021
regulation of melanocyte differentiation decreased process quality, abnormal alx4aj320/j320 standard conditions Fig. 4 with image from Jang et al., 2021
regulation of iridophore differentiation decreased process quality, abnormal alx4aj320/j320 standard conditions Fig. 4 with image from Jang et al., 2021
regulation of melanocyte differentiation decreased process quality, abnormal alx4aj321b/j321b standard conditions Fig. 4 with image from Jang et al., 2021
iridophore decreased amount, abnormal alx4aj321b/j321b standard conditions Fig. 4 with image from Jang et al., 2021
regulation of iridophore differentiation decreased process quality, abnormal alx4aj321b/j321b standard conditions Fig. 4 with image from Jang et al., 2021
regulation of melanocyte differentiation decreased process quality, abnormal alx4aj322a/j322a standard conditions Fig. 4 with image from Jang et al., 2021
iridophore decreased amount, abnormal alx4aj322a/j322a standard conditions Fig. 4 with image from Jang et al., 2021
regulation of iridophore differentiation decreased process quality, abnormal alx4aj322a/j322a standard conditions Fig. 4 with image from Jang et al., 2021
regulation of melanocyte differentiation decreased process quality, abnormal alx4aj322b/j322b standard conditions Fig. 4 with image from Jang et al., 2021
iridophore decreased amount, abnormal alx4aj322b/j322b standard conditions Fig. 4 with image from Jang et al., 2021
regulation of iridophore differentiation decreased process quality, abnormal alx4aj322b/j322b standard conditions Fig. 4 with image from Jang et al., 2021
regulation of melanocyte differentiation decreased process quality, abnormal alx4aj323a/j323a standard conditions Fig. 4 with image from Jang et al., 2021
iridophore decreased amount, abnormal alx4aj323a/j323a standard conditions Fig. 4 with image from Jang et al., 2021
regulation of iridophore differentiation decreased process quality, abnormal alx4aj323a/j323a standard conditions Fig. 4 with image from Jang et al., 2021
regulation of melanocyte differentiation decreased process quality, abnormal alx4aj323b/j323b standard conditions Fig. 4 with image from Jang et al., 2021
iridophore decreased amount, abnormal alx4aj323b/j323b standard conditions Fig. 4 with image from Jang et al., 2021
regulation of iridophore differentiation decreased process quality, abnormal alx4aj323b/j323b standard conditions Fig. 4 with image from Jang et al., 2021
regulation of melanocyte differentiation decreased process quality, abnormal alx4aj324/j324 standard conditions Fig. 4 with image from Jang et al., 2021
iridophore decreased amount, abnormal alx4aj324/j324 standard conditions Fig. 4 with image from Jang et al., 2021
regulation of iridophore differentiation decreased process quality, abnormal alx4aj324/j324 standard conditions Fig. 4 with image from Jang et al., 2021
iridophore decreased amount, abnormal alx4aj325a/j325a standard conditions Fig. 4 with image from Jang et al., 2021
regulation of melanocyte differentiation decreased process quality, abnormal alx4aj325a/j325a standard conditions Fig. 4 with image from Jang et al., 2021
regulation of iridophore differentiation decreased process quality, abnormal alx4aj325a/j325a standard conditions Fig. 4 with image from Jang et al., 2021
iridophore decreased amount, abnormal alx4aj325b/j325b standard conditions Fig. 4 with image from Jang et al., 2021
regulation of melanocyte differentiation decreased process quality, abnormal alx4aj325b/j325b standard conditions Fig. 4 with image from Jang et al., 2021
regulation of iridophore differentiation decreased process quality, abnormal alx4aj325b/j325b standard conditions Fig. 4 with image from Jang et al., 2021
regulation of iridophore differentiation decreased process quality, abnormal alx4aj326b/j326b standard conditions Fig. 4 with image from Jang et al., 2021
iridophore decreased amount, abnormal alx4aj326b/j326b standard conditions Fig. 4 with image from Jang et al., 2021
regulation of melanocyte differentiation decreased process quality, abnormal alx4aj326b/j326b standard conditions Fig. 4 with image from Jang et al., 2021
iridophore amount, ameliorated alx4aj321b/j321b; j330Tg/j330Tg standard conditions Fig. 4 with image from Jang et al., 2021
Citations