CRISPR

CRISPR1-slc1a2b

ID

ZDB-CRISPR-230804-6

Name

CRISPR1-slc1a2b

Previous Names

None

Target

slc1a2b (1)

Sequence

5' - GGTCTGGATGCCAAGTCGAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zh7	slc1a2b

Expression

Gene expression in Wild Types + CRISPR1-slc1a2b

No data available

Phenotype

Phenotype resulting from CRISPR1-slc1a2b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-slc1a2b

Phenotype	Fish	Conditions	Figures
whole organism decreased length, abnormal	slc1a2b^zh7/zh7	standard conditions	Fig. 2 from Hotz et al., 2021
swim bladder uninflated, abnormal	slc1a2b^zh7/zh7	standard conditions	Fig. 2 from Hotz et al., 2021
swimming decreased process quality, abnormal	slc1a2b^zh7/zh7	standard conditions	Fig. 3 from Hotz et al., 2021
whole organism decreased life span, abnormal	slc1a2b^zh7/zh7	standard conditions	Fig. 2 from Hotz et al., 2021
swimming irregular duration, abnormal	slc1a2b^zh7/zh7	standard conditions	Fig. 3 from Hotz et al., 2021
brain regulation of neuronal action potential decreased process quality, abnormal	slc1a2b^zh7/zh7	standard conditions	Fig. 2 , Fig. 3 from Hotz et al., 2021
brain gad1b expression increased amount, abnormal	slc1a2b^zh7/zh7	standard conditions	Fig. 5 from Hotz et al., 2021
brain slc1a3b expression increased amount, abnormal	slc1a2b^zh7/zh7	standard conditions	Fig. 5 from Hotz et al., 2021
heart edematous, abnormal	slc1a2b^zh7/zh7	standard conditions	Fig. 2 from Hotz et al., 2021
brain neuronal action potential increased process quality, abnormal	slc1a2b^zh7/+; jf4Tg	visible light	Fig. 2 from Hotz et al., 2021
telencephalon glutamate(1-) increased amount, abnormal	slc1a2b^zh7/zh7; cu3313Tg	standard conditions	Fig. 3 from Hotz et al., 2021
telencephalon extracellular space cpEGFP expression increased amount, abnormal	slc1a2b^zh7/zh7; cu3313Tg	standard conditions	Fig. 3 from Hotz et al., 2021
brain regulation of neuronal action potential decreased process quality, abnormal	slc1a2b^zh7/zh7; cu3313Tg	standard conditions	Fig. 3 from Hotz et al., 2021
telencephalon neuronal action potential increased process quality, abnormal	slc1a2b^zh7/zh7; cu3313Tg	standard conditions	Fig. 3 from Hotz et al., 2021
brain GCaMP expression increased amount, abnormal	slc1a2b^zh7/zh7; jf4Tg	visible light	Fig. 2 from Hotz et al., 2021
brain regulation of neuronal action potential decreased process quality, abnormal	slc1a2b^zh7/zh7; jf4Tg	visible light	Fig. 2 from Hotz et al., 2021
brain neuronal action potential increased process quality, exacerbated	slc1a2b^zh7/zh7; jf4Tg	visible light	Fig. 2 from Hotz et al., 2021
brain regulation of neuronal action potential decreased process quality, abnormal	slc1a2b^zh7/zh7; nkUAShspzGCaMP6s13aTg; nw7Tg	standard conditions	Fig. 5 from Hotz et al., 2021
astrocyte regulation of glutamate uptake involved in transmission of nerve impulse decreased process quality, abnormal	slc1a2b^zh7/zh7; nkUAShspzGCaMP6s13aTg; nw7Tg	standard conditions	Fig. 5 from Hotz et al., 2021
brain neuronal action potential occurrence, abnormal	slc1a2b^zh7/zh7; nkUAShspzGCaMP6s13aTg; nw7Tg	standard conditions	Fig. 5 from Hotz et al., 2021
brain neuronal action potential increased spatial extent of a process, abnormal	slc1a2b^zh7/zh7; nkUAShspzGCaMP6s13aTg; nw7Tg	standard conditions	Fig. 5 from Hotz et al., 2021
brain regulation of neuronal action potential decreased process quality, abnormal	slc1a2b^zh7/zh7; zf498Tg	standard conditions	Fig. 4 from Hotz et al., 2021
brain neuronal action potential occurrence, abnormal	slc1a2b^zh7/zh7; zf498Tg	visible light	Fig. 4 from Hotz et al., 2021
brain neuronal action potential occurrence, abnormal	slc1a2b^zh7/zh7; zf498Tg	standard conditions	Fig. 4 from Hotz et al., 2021
brain GCaMP expression increased amount, abnormal	slc1a2b^zh7/zh7; zf498Tg	visible light	Fig. 4 from Hotz et al., 2021
brain regulation of neuronal action potential decreased process quality, abnormal	slc1a2b^zh7/zh7; zf498Tg	visible light	Fig. 4 from Hotz et al., 2021
brain neuronal action potential increased spatial extent of a process, abnormal	slc1a2b^zh7/zh7; zf498Tg	standard conditions	Fig. 4 from Hotz et al., 2021
brain neuronal action potential increased spatial extent of a process, abnormal	slc1a2b^zh7/zh7; zf498Tg	visible light	Fig. 4 from Hotz et al., 2021

Citations