CRISPR

CRISPR4-kars1

ID

ZDB-CRISPR-230602-2

Name

CRISPR4-kars1

Previous Names

None

Target

kars1 (1)

Sequence

5' - GGTGGTCTCCAGGCTGAAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The first two "Gs were added.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
omf3	kars1

Expression

Gene expression in Wild Types + CRISPR4-kars1

No data available

Phenotype

Phenotype resulting from CRISPR4-kars1

No data available

Phenotype of all Fish created by or utilizing CRISPR4-kars1

Phenotype	Fish	Conditions	Figures
head decreased size, abnormal	kars1^omf3/omf3 (NHGRI-1)	standard conditions	Fig. S7 from Lin et al., 2021
eye decreased size, abnormal	kars1^omf3/omf3 (NHGRI-1)	standard conditions	Fig. S7 from Lin et al., 2021
pericardium edematous, abnormal	kars1^omf3/omf3 (NHGRI-1)	standard conditions	Fig. S7 from Lin et al., 2021
otic vesicle decreased size, abnormal	kars1^omf3/omf3 (NHGRI-1)	standard conditions	Fig. S7 from Lin et al., 2021
whole organism dead, abnormal	kars1^omf3/omf3 (NHGRI-1)	standard conditions	Fig. S7 from Lin et al., 2021
swim bladder uninflated, abnormal	kars1^omf3/omf3 (NHGRI-1)	standard conditions	Fig. S7 from Lin et al., 2021
whole organism kars1 expression decreased amount, abnormal	kars1^omf3/omf3 (NHGRI-1)	standard conditions	Fig. S6 from Lin et al., 2021
brain spongy, abnormal	NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1	standard conditions	Fig. 4 from Lin et al., 2021
retina layer formation disrupted, abnormal	NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1	standard conditions	Fig. 4 from Lin et al., 2021
head decreased size, abnormal	NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1	standard conditions	Fig. 4 from Lin et al., 2021
brain vacuolated, abnormal	NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1	standard conditions	Fig. 4 from Lin et al., 2021
eye decreased size, abnormal	NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1	standard conditions	Fig. 4 from Lin et al., 2021
whole organism viability, abnormal	NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1	standard conditions	Fig. 4 from Lin et al., 2021
eye decreased volume, abnormal	NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1	standard conditions	Fig. 4 from Lin et al., 2021
retina morphology, abnormal	NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1	standard conditions	Fig. 4 from Lin et al., 2021
head size, ameliorated	NHGRI-1 + CRISPR19-tp53 + CRISPR20-tp53 + CRISPR21-tp53 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1	standard conditions	Fig. 4 from Lin et al., 2021
whole organism viability, ameliorated	NHGRI-1 + CRISPR19-tp53 + CRISPR20-tp53 + CRISPR21-tp53 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1	standard conditions	Fig. 4 from Lin et al., 2021
retina morphology, ameliorated	NHGRI-1 + CRISPR19-tp53 + CRISPR20-tp53 + CRISPR21-tp53 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1	standard conditions	Fig. 4 from Lin et al., 2021
eye size, ameliorated	NHGRI-1 + CRISPR19-tp53 + CRISPR20-tp53 + CRISPR21-tp53 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1	standard conditions	Fig. 4 from Lin et al., 2021
brain structure, ameliorated	NHGRI-1 + CRISPR19-tp53 + CRISPR20-tp53 + CRISPR21-tp53 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1	standard conditions	Fig. 4 from Lin et al., 2021

Citations