CRISPR

CRISPR1-adgrl2a

ID

ZDB-CRISPR-230524-8

Name

CRISPR1-adgrl2a

Previous Names

None

Target

adgrl2a (1)

Sequence

5' - CAACCGTCAAGACGAATACAAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
uto63	adgrl2a

Expression

Gene expression in Wild Types + CRISPR1-adgrl2a

No data available

Phenotype

Phenotype resulting from CRISPR1-adgrl2a

No data available

Phenotype of all Fish created by or utilizing CRISPR1-adgrl2a

Phenotype	Fish	Conditions	Figures
blood vasculature hippo signaling increased process quality, abnormal	adgrl2a^uto63/uto63; ia49Tg; s843Tg (AB)	standard conditions	Fig. 4 from Camillo et al., 2021
dorsal aorta endothelial cell mCherry expression increased distribution, abnormal	adgrl2a^uto63/uto63; ia49Tg; s843Tg (AB)	standard conditions	Fig. 4 from Camillo et al., 2021
endothelial cell ccn1 expression increased amount, abnormal	adgrl2a^uto63/uto63; ia49Tg; s843Tg (AB)	standard conditions	Fig. 4 from Camillo et al., 2021
intersegmental vessel endothelial cell mCherry expression increased distribution, abnormal	adgrl2a^uto63/uto63; ia49Tg; s843Tg (AB)	standard conditions	Fig. 4 from Camillo et al., 2021
posterior cardinal vein endothelial cell mCherry expression increased distribution, abnormal	adgrl2a^uto63/uto63; ia49Tg; s843Tg (AB)	standard conditions	Fig. 4 from Camillo et al., 2021
endothelial cell mCherry expression increased amount, abnormal	adgrl2a^uto63/uto63; ia49Tg; s843Tg (AB)	standard conditions	Fig. 4 from Camillo et al., 2021
endothelial cell ccn2a expression increased amount, abnormal	adgrl2a^uto63/uto63; ia49Tg; s843Tg (AB)	standard conditions	Fig. 4 from Camillo et al., 2021
intersegmental vessel endothelial cell ab1-tjp1 labeling decreased distribution, abnormal	adgrl2a^uto63/uto63; s843Tg (AB)	standard conditions	Fig. 4 from Camillo et al., 2021
intersegmental vessel permeability, exacerbated	adgrl2a^uto63/uto63; s843Tg (AB)	chemical treatment by injection: VEGF activator	Fig. 5 from Camillo et al., 2021
endothelial cell tight junction structurally discontinuous, abnormal	adgrl2a^uto63/uto63; s843Tg (AB)	standard conditions	Fig. 4 from Camillo et al., 2021
endothelial cell decreased size, abnormal	adgrl2a^uto63/uto63; s843Tg (AB)	standard conditions	Fig. 4 from Camillo et al., 2021
endothelial cell flrt2 expression increased amount, abnormal	adgrl2a^uto63/uto63; s843Tg (AB)	standard conditions	Fig. S3 from Camillo et al., 2021
intersegmental vessel endothelial cell ab1-tjp1 labeling spatial pattern, abnormal	adgrl2a^uto63/uto63; s843Tg (AB)	standard conditions	Fig. 4 from Camillo et al., 2021
dorsal aorta endothelial cell Ab1-adgrl2a labeling absent, abnormal	adgrl2a^uto63/uto63; s843Tg (AB)	standard conditions	Fig. 4 from Camillo et al., 2021
intersegmental vessel increased permeability, abnormal	adgrl2a^uto63/uto63; s843Tg (AB)	standard conditions	Fig. 5 from Camillo et al., 2021
endothelial cell tight junction fragmented, abnormal	adgrl2a^uto63/uto63; s843Tg (AB)	standard conditions	Fig. 4 from Camillo et al., 2021
posterior cardinal vein endothelial cell Ab1-adgrl2a labeling absent, abnormal	adgrl2a^uto63/uto63; s843Tg (AB)	standard conditions	Fig. 4 from Camillo et al., 2021
blood vasculature endothelial cell decreased thickness, abnormal	adgrl2a^uto63/uto63; s843Tg (AB)	standard conditions	Fig. 4 from Camillo et al., 2021

Citations