CRISPR

CRISPR1-rnf2

ID
ZDB-CRISPR-230320-1
Name
CRISPR1-rnf2
Previous Names
None
Target
Sequence
5' - GGAGGCCATCACGGATGGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihb806 rnf2
ihb808 rnf2
Expression
Gene expression in Wild Types + CRISPR1-rnf2
No data available
Phenotype
Phenotype resulting from CRISPR1-rnf2
No data available
Phenotype of all Fish created by or utilizing CRISPR1-rnf2
Phenotype Fish Conditions Figures
midbrain tfap2a expression decreased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 6 with image from Feng et al., 2022
atrioventricular valve structure, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 1 with image from Peng et al., 2021
heart heart contraction decreased process quality, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 1 with image,  Figure 2 with image from Peng et al., 2021
midbrain neurod1 expression absent, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 6 with image from Feng et al., 2022
whole organism Ab3-rnf2 labeling absent, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 1 with image from Peng et al., 2021
cardiac conduction system decreased functionality, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 6 with image from Peng et al., 2021
atrioventricular canal vcana expression spatial pattern, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 6 with image from Peng et al., 2021
neural crest vgll2a expression decreased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 5 with image from Feng et al., 2022
sinoatrial node cardiac muscle cell decreased amount, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 6 with image from Peng et al., 2021
midbrain hindbrain boundary neural rod pax2a expression decreased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 7 with image from Feng et al., 2022
atrioventricular canal bmp4 expression spatial pattern, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 6 with image from Peng et al., 2021
gut neuron migration decreased process quality, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 2 with image from Feng et al., 2022
gut ret expression decreased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 2 with image from Feng et al., 2022
hindbrain neural rod cyp26c1 expression decreased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 7 with image from Feng et al., 2022
atrioventricular canal increased width, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 1 with image from Peng et al., 2021
neural crest foxd3 expression decreased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 4 with image from Feng et al., 2022
brain phox2bb expression mislocalised, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 2 with image from Feng et al., 2022
pericardium edematous, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 1 with image from Peng et al., 2021
heart calcium-mediated signaling decreased process quality, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 6 with image from Peng et al., 2021
midbrain hindbrain boundary neural rod pax2a expression spatial pattern, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 7 with image from Feng et al., 2022
atrioventricular canal vcana expression increased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 6 with image from Peng et al., 2021
neural crest cxcr4a expression decreased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 5 with image from Feng et al., 2022
heart heart contraction decreased rate of occurrence, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 2 with image from Peng et al., 2021
gut hand2 expression decreased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 2 with image from Feng et al., 2022
heart morphology, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 1 with image from Peng et al., 2021
midbrain hindbrain boundary neurod1 expression absent, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 6 with image from Feng et al., 2022
cardiac muscle cell organization quality, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 5 with image from Peng et al., 2021
eye phox2a expression decreased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 6 with image from Feng et al., 2022
neural plate prdm1a expression decreased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 5 with image from Feng et al., 2022
head morphology, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 1 with image from Peng et al., 2021
neural crest sox1b expression mislocalised, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 4 with image from Feng et al., 2022
eye decreased size, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 1 with image from Peng et al., 2021
atrioventricular canal alcama expression spatial pattern, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 6 with image from Peng et al., 2021
neural crest prdm1a expression spatial pattern, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 5 with image from Feng et al., 2022
hindbrain neural rod egr2b expression decreased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 7 with image from Feng et al., 2022
pectoral fin absence of anatomical entity, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 1 with image from Peng et al., 2021
midbrain hindbrain boundary egr2b expression decreased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 6 with image from Feng et al., 2022
cardiac ventricle fusiform, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 1 with image from Peng et al., 2021
brain neuron differentiation decreased process quality, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 8 with image from Feng et al., 2022
neural crest sox9b expression decreased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 4 with image from Feng et al., 2022
whole organism dead, abnormal rnf2ihb806/ihb806 (AB) standard conditions text only from Peng et al., 2021
central nervous system neurog1 expression decreased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 7 with image from Feng et al., 2022
atrioventricular canal alcama expression increased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 6 with image from Peng et al., 2021
cardiac muscle Z disc increased width, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 5 with image from Peng et al., 2021
atrioventricular valve morphology, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 1 with image from Peng et al., 2021
atrium fusiform, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 1 with image from Peng et al., 2021
neural plate border foxd3 expression decreased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 4 with image from Feng et al., 2022
gut phox2bb expression decreased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 2 with image from Feng et al., 2022
heart myl7 expression spatial pattern, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 4 with image from Peng et al., 2021
cardiac muscle I band increased width, abnormal rnf2ihb806/ihb806 (AB) standard conditions Figure 5 with image from Peng et al., 2021
neural crest nes expression decreased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 4 with image from Feng et al., 2022
gut neuron decreased amount, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 3 with image from Feng et al., 2022
hindbrain tfap2a expression decreased distribution, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 6 with image from Feng et al., 2022
neural crest sox1b expression spatial pattern, abnormal rnf2ihb806/ihb806 (AB) standard conditions FIGURE 4 with image from Feng et al., 2022
cardiac ventricle fusiform, abnormal rnf2ihb808/ihb808 (AB) standard conditions Figure 1 with image from Peng et al., 2021
pectoral fin absence of anatomical entity, abnormal rnf2ihb808/ihb808 (AB) standard conditions Figure 1 with image from Peng et al., 2021
atrioventricular canal increased width, abnormal rnf2ihb808/ihb808 (AB) standard conditions Figure 1 with image from Peng et al., 2021
whole organism dead, abnormal rnf2ihb808/ihb808 (AB) standard conditions text only from Peng et al., 2021
head morphology, abnormal rnf2ihb808/ihb808 (AB) standard conditions Figure 1 with image from Peng et al., 2021
atrium fusiform, abnormal rnf2ihb808/ihb808 (AB) standard conditions Figure 1 with image from Peng et al., 2021
eye decreased size, abnormal rnf2ihb808/ihb808 (AB) standard conditions Figure 1 with image from Peng et al., 2021
pericardium edematous, abnormal rnf2ihb808/ihb808 (AB) standard conditions Figure 1 with image from Peng et al., 2021
atrioventricular valve structure, abnormal rnf2ihb808/ihb808 (AB) standard conditions Figure 1 with image from Peng et al., 2021
heart morphology, abnormal rnf2ihb808/ihb808 (AB) standard conditions Figure 1 with image from Peng et al., 2021
atrioventricular valve morphology, abnormal rnf2ihb808/ihb808 (AB) standard conditions Figure 1 with image from Peng et al., 2021
heart heart contraction decreased process quality, abnormal rnf2ihb808/ihb808 (AB) standard conditions Figure 1 with image from Peng et al., 2021
whole organism Ab3-rnf2 labeling absent, abnormal rnf2ihb808/ihb808 (AB) standard conditions Figure 1 with image from Peng et al., 2021
heart tnni2b.1 expression decreased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
heart mylk2 expression increased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
heart tube myh11a expression decreased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
heart tube myl9b expression increased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
heart tube acta2 expression increased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
heart tube mylk2 expression decreased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
heart myh11a expression increased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
heart myl9b expression increased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
heart tube myl1 expression increased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
heart acta2 expression increased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
heart acta1a expression increased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
heart tube tnnt3a expression increased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
heart tube acta2 expression decreased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
heart tube myh11a expression increased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
heart myl1 expression decreased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
heart tube acta1a expression increased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
heart tube tnni2b.1 expression increased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
heart tnnt3a expression decreased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
heart acta1b expression increased amount, abnormal rnf2ihb806/ihb806; f1Tg (AB) standard conditions Figure 5 with image from Peng et al., 2021
brain EGFP expression increased distribution, abnormal rnf2ihb806/ihb806; ihb807Tg (AB) standard conditions FIGURE 2 with image from Feng et al., 2022
gut EGFP expression decreased distribution, abnormal rnf2ihb806/ihb806; ihb807Tg (AB) standard conditions FIGURE 2 with image from Feng et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.