CRISPR

CRISPR5-urp2

ID

ZDB-CRISPR-230209-4

Name

CRISPR5-urp2

Previous Names

None

Target

urp2 (1)

Sequence

5' - GGCGTTTGCAGAAATCAGCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The first two "G"s were added.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
b1421	urp2

Expression

Gene expression in Wild Types + CRISPR5-urp2

No data available

Phenotype

Phenotype resulting from CRISPR5-urp2

No data available

Phenotype of all Fish created by or utilizing CRISPR5-urp2

Phenotype	Fish	Conditions	Figures
male organism skeletal system development decreased process quality, abnormal	urp2^b1421/b1421; urp1^b1420/b1420 (AB)	standard conditions	Figure 2 from Bearce et al., 2022
female organism skeletal system development decreased process quality, abnormal	urp2^b1421/b1421; urp1^b1420/b1420 (AB)	standard conditions	Figure 2 , Figure 4 from Bearce et al., 2022
vertebral column posterior region curved, abnormal	urp2^b1421/b1421; urp1^b1420/b1420 (AB)	standard conditions	Figure 2 from Bearce et al., 2022
male organism vertebral column curved, abnormal	urp2^b1421/b1421; urp1^b1420/b1420 (AB)	standard conditions	Figure 2 from Bearce et al., 2022
vertebral column curved, abnormal	urp2^b1421/b1421; urp1^b1420/b1420 (AB)	standard conditions	Figure 3 from Bearce et al., 2022
vertebral column posterior region curved dorsal, abnormal	urp2^b1421/b1421; urp1^b1420/b1420 (AB)	standard conditions	Figure 4 from Bearce et al., 2022
vertebral column posterior region curved ventral, abnormal	urp2^b1421/b1421; urp1^b1420/b1420 (AB)	standard conditions	Figure 4 from Bearce et al., 2022
vertebral column curved ventral, abnormal	urp2^b1421/b1421; urp1^b1420/b1420 (AB)	standard conditions	Figure 3 from Bearce et al., 2022
vertebral column skeletal system development decreased process quality, abnormal	urp2^b1421/b1421; urp1^b1420/b1420 (AB)	standard conditions	Figure 2 , Figure 3 from Bearce et al., 2022
vertebral column undulate, abnormal	urp2^b1421/b1421; urp1^b1420/b1420 (AB)	standard conditions	Figure 2 , Figure 3 from Bearce et al., 2022
female organism vertebral column curved, abnormal	urp2^b1421/b1421; urp1^b1420/b1420 (AB)	standard conditions	Figure 2 from Bearce et al., 2022
vertebral column curved dorsal, abnormal	cfap298^tm304/tm304; urp2^b1421/b1421; urp1^b1420/b1420 (AB)	standard conditions	Figure 4 from Bearce et al., 2022
vertebral column anterior region curved, abnormal	cfap298^tm304/tm304; urp2^b1421/b1421; urp1^b1420/b1420 (AB)	standard conditions	Figure 4 from Bearce et al., 2022
vertebral column posterior region curved, abnormal	cfap298^tm304/tm304; urp2^b1421/b1421; urp1^b1420/b1420 (AB)	standard conditions	Figure 4 from Bearce et al., 2022
vertebral column curved lateral, abnormal	cfap298^tm304/tm304; urp2^b1421/b1421; urp1^b1420/b1420 (AB)	standard conditions	Figure 4 from Bearce et al., 2022
vertebral column curved medial, abnormal	cfap298^tm304/tm304; urp2^b1421/b1421; urp1^b1420/b1420 (AB)	standard conditions	Figure 4 from Bearce et al., 2022
female organism skeletal system development decreased process quality, abnormal	cfap298^tm304/tm304; urp2^b1421/b1421; urp1^b1420/b1420 (AB)	standard conditions	Figure 4 from Bearce et al., 2022
vertebral column curved ventral, abnormal	cfap298^tm304/tm304; urp2^b1421/b1421; urp1^b1420/b1420 (AB)	standard conditions	Figure 4 from Bearce et al., 2022

Citations