CRISPR

CRISPR2-urp1

ID
ZDB-CRISPR-230209-1
Name
CRISPR2-urp1
Previous Names
None
Target
Sequence
5' - GGCGTTGGTCAGCCTGACAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This CRISPR targets intron 4. The first two "G"s were added.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
b1420 urp1
Expression
Gene expression in Wild Types + CRISPR2-urp1
No data available
Phenotype
Phenotype resulting from CRISPR2-urp1
No data available
Phenotype of all Fish created by or utilizing CRISPR2-urp1
Phenotype Fish Conditions Figures
male organism skeletal system development decreased process quality, abnormal urp2b1421/b1421; urp1b1420/b1420 (AB) standard conditions Figure 2 with image from Bearce et al., 2022
female organism skeletal system development decreased process quality, abnormal urp2b1421/b1421; urp1b1420/b1420 (AB) standard conditions Figure 2 with imageFigure 4 with image from Bearce et al., 2022
vertebral column posterior region curved, abnormal urp2b1421/b1421; urp1b1420/b1420 (AB) standard conditions Figure 2 with image from Bearce et al., 2022
male organism vertebral column curved, abnormal urp2b1421/b1421; urp1b1420/b1420 (AB) standard conditions Figure 2 with image from Bearce et al., 2022
vertebral column curved, abnormal urp2b1421/b1421; urp1b1420/b1420 (AB) standard conditions Figure 3 with image from Bearce et al., 2022
vertebral column posterior region curved dorsal, abnormal urp2b1421/b1421; urp1b1420/b1420 (AB) standard conditions Figure 4 with image from Bearce et al., 2022
vertebral column posterior region curved ventral, abnormal urp2b1421/b1421; urp1b1420/b1420 (AB) standard conditions Figure 4 with image from Bearce et al., 2022
vertebral column curved ventral, abnormal urp2b1421/b1421; urp1b1420/b1420 (AB) standard conditions Figure 3 with image from Bearce et al., 2022
vertebral column skeletal system development decreased process quality, abnormal urp2b1421/b1421; urp1b1420/b1420 (AB) standard conditions Figure 2 with imageFigure 3 with image from Bearce et al., 2022
vertebral column undulate, abnormal urp2b1421/b1421; urp1b1420/b1420 (AB) standard conditions Figure 2 with imageFigure 3 with image from Bearce et al., 2022
female organism vertebral column curved, abnormal urp2b1421/b1421; urp1b1420/b1420 (AB) standard conditions Figure 2 with image from Bearce et al., 2022
vertebral column curved dorsal, abnormal cfap298tm304/tm304; urp2b1421/b1421; urp1b1420/b1420 (AB) standard conditions Figure 4 with image from Bearce et al., 2022
vertebral column anterior region curved, abnormal cfap298tm304/tm304; urp2b1421/b1421; urp1b1420/b1420 (AB) standard conditions Figure 4 with image from Bearce et al., 2022
vertebral column posterior region curved, abnormal cfap298tm304/tm304; urp2b1421/b1421; urp1b1420/b1420 (AB) standard conditions Figure 4 with image from Bearce et al., 2022
vertebral column curved lateral, abnormal cfap298tm304/tm304; urp2b1421/b1421; urp1b1420/b1420 (AB) standard conditions Figure 4 with image from Bearce et al., 2022
vertebral column curved medial, abnormal cfap298tm304/tm304; urp2b1421/b1421; urp1b1420/b1420 (AB) standard conditions Figure 4 with image from Bearce et al., 2022
female organism skeletal system development decreased process quality, abnormal cfap298tm304/tm304; urp2b1421/b1421; urp1b1420/b1420 (AB) standard conditions Figure 4 with image from Bearce et al., 2022
vertebral column curved ventral, abnormal cfap298tm304/tm304; urp2b1421/b1421; urp1b1420/b1420 (AB) standard conditions Figure 4 with image from Bearce et al., 2022
Citations