CRISPR

CRISPR1-lrrk2,slc2a13b

ID
ZDB-CRISPR-230208-1
Name
CRISPR1-lrrk2,slc2a13b
Previous Names
  • CRISPR4-lrrk2
Targets
Sequence
5' - GGGATGTTAATGTGTCAACA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3 end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
tud113 lrrk2
Expression
Gene expression in Wild Types + CRISPR1-lrrk2,slc2a13b
No data available
Phenotype
Phenotype resulting from CRISPR1-lrrk2,slc2a13b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-lrrk2,slc2a13b
Phenotype Fish Conditions Figures
brain monoamine oxidase activity increased magnitude, abnormal lrrk2tud113/tud113 standard conditions Fig 4 with image from Suzzi et al., 2021
paraventricular organ ab1-th labeling decreased amount, abnormal lrrk2tud113/tud113 standard conditions Fig 3 with image from Suzzi et al., 2021
telencephalon ab1-th labeling decreased amount, abnormal lrrk2tud113/tud113 standard conditions Fig 3 with image from Suzzi et al., 2021
hindbrain cell death increased frequency, abnormal lrrk2tud113/tud113 standard conditions Fig 2 with image from Suzzi et al., 2021
telencephalon cell death increased frequency, abnormal lrrk2tud113/tud113 standard conditions Fig 2 with image from Suzzi et al., 2021
brain dopamine biosynthetic process decreased magnitude, abnormal lrrk2tud113/tud113 standard conditions Fig 4 with image from Suzzi et al., 2021
brain serotonin biosynthetic process decreased magnitude, abnormal lrrk2tud113/tud113 standard conditions Fig 4 with image from Suzzi et al., 2021
midbrain cell death increased frequency, abnormal lrrk2tud113/tud113 standard conditions Fig 2 with image from Suzzi et al., 2021
olfactory bulb ab1-th labeling decreased amount, abnormal lrrk2tud113/tud113 standard conditions Fig 3 with image from Suzzi et al., 2021
telencephalon ab1-th labeling increased amount, abnormal lrrk2tud113/tud113 standard conditions Fig 3 with image from Suzzi et al., 2021
microglial cell ab2-lcp1 labeling decreased amount, abnormal lrrk2tud113/tud113 standard conditions Fig 2 with image from Suzzi et al., 2021
diencephalon ab1-th labeling decreased amount, abnormal lrrk2tud113/tud113 standard conditions Fig 3 with image from Suzzi et al., 2021
hindbrain commissure ab1-cldnk labeling decreased amount, abnormal lrrk2tud113/tud113 standard conditions Fig 2 with image from Suzzi et al., 2021
hindbrain myelin sheath disorganized, abnormal lrrk2tud113/tud113 standard conditions Fig 2 with image from Suzzi et al., 2021
leukocyte ab2-lcp1 labeling decreased amount, abnormal lrrk2tud113/tud113 standard conditions Fig 2 with image from Suzzi et al., 2021
diencephalon cell death increased frequency, abnormal lrrk2tud113/tud113 standard conditions Fig 2 with image from Suzzi et al., 2021
whole organism lrrk2 expression decreased amount, abnormal lrrk2tud113/tud113 standard conditions Fig 1 with image from Suzzi et al., 2021
Citations